Skip to Content
Merck
All Photos(1)

Documents

EHU106231

Sigma-Aldrich

MISSION® esiRNA

targeting human PGD

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGTTCCAAGACACCGATGGCAAACACCTGCTGCCAAAGATCAGGGACAGCGCGGGGCAGAAGGGCACAGGGAAGTGGACCGCCATCTCCGCCCTGGAATACGGCGTACCCGTCACCCTCATTGGAGAAGCTGTCTTTGCTCGGTGCTTATCATCTCTGAAGGATGAGAGAATTCAAGCTAGCAAAAAGCTGAAGGGTCCCCAGAAGTTCCAGTTTGATGGTGATAAGAAATCATTCCTGGAGGACATTCGGAAGGCACTCTACGCTTCCAAGATCATCTCTTACGCTCAAGGCTTTATGCTGCTAAGGCAGGCAGCCACCGAGTTTGGCTGGACTCTCAATTATGGTGGCATCGCCCTGATGTGGAGAGGGGGCTGCATCATTAGAAGTGTATTCCTAGGAAAGATAAAGGATGCATTTGATCGAAACC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jun Cao et al.
The American journal of the medical sciences, 360(3), 279-286 (2020-08-25)
The essential role of 6-phosphogluconate dehydrogenase (6PGD), the enzyme catalyzing the oxidative pentose phosphate pathway, in tumor growth and metabolism has garnered attention in recent years. In this work, we are the first to demonstrate that aberrant activation of 6PGD
Xiaoyu Yang et al.
Clinical & translational oncology : official publication of the Federation of Spanish Oncology Societies and of the National Cancer Institute of Mexico, 20(9), 1145-1152 (2018-01-18)
6-phosphogluconate dehydrogenase (6PGD), a key enzyme of the oxidative pentose phosphate pathway, is involved in tumor growth and metabolism. Although high 6PGD activity has been shown to be associated with poor prognosis, its role and therapeutic value in breast cancer
Wujian Zheng et al.
Frontiers in pharmacology, 8, 421-421 (2017-07-18)
Cisplatin (DDP) is currently one of the most commonly used chemotherapeutic drugs for treating ovarian and lung cancer. However, resistance to cisplatin is common and it often leads to therapy failure. In addition, the precise mechanism of cisplatin resistance is

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service