Skip to Content
Merck
All Photos(1)

Key Documents

EHU095461

Sigma-Aldrich

MISSION® esiRNA

targeting human CCL20

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAAGCAACTTTGACTGCTGTCTTGGATACACAGACCGTATTCTTCATCCTAAATTTATTGTGGGCTTCACACGGCAGCTGGCCAATGAAGGCTGTGACATCAATGCTATCATCTTTCACACAAAGAAAAAGTTGTCTGTGTGCGCAAATCCAAAACAGACTTGGGTGAAATATATTGTGCGTCTCCTCAGTAAAAAAGTCAAGAACATGTAAAAACTGTGGCTTTTCTGGAATGGAATTGGACATAGCCCAAGAACAGAAAGAACCTTGCTGGGGTTGGAGGTTTCACTTGCACATCATGGAGGGTTTAGTGCTTATCTAATTTGTGCCTCACTGGACTTG

Ensembl | human accession no.

ENSG00000115009

NCBI accession no.

NM_004591

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CCL20(6364) , CCL20(6364)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Li-Shang Liao et al.
Aging, 12(14), 14849-14862 (2020-06-24)
Recent evidence suggests that CC chemokine ligand 20 (CCL20) is upregulated after subarachnoid hemorrhage (SAH). Here, we investigated the functions of CCL20 in SAH injury and its underlying mechanisms of action. We found that CCL20 is upregulated in an SAH
Qiang Fu et al.
Biotechnology letters, 43(2), 393-405 (2020-11-10)
Myocardial infarction (MI) is a prevalent cardiovascular puzzle and a mainspring of disease-induced mortality. We performed this investigation to detect the role of putative important miRNAs or genes in MI. CCL20 may be a potential therapeutic target, which was directly
Masaaki Murakami et al.
The Journal of experimental medicine, 208(1), 103-114 (2011-01-12)
Cognate antigen recognition by CD4(+) T cells is thought to contribute to the tissue specificity of various autoimmune diseases, particularly those associated with class II MHC alleles. However, we show that localized class II MHC-dependent arthritis in F759 mice depends

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service