description
Powered by Eupheria Biotech
Quality Level
product line
MISSION®
form
lyophilized powder
esiRNA cDNA target sequence
TGTTGGTGCACTGGACACTTTTATTGCTGCAGTATATGAGCATGCGGTGATATTACCAAACAGAACAGAAACACCTGTTTCAAAAGAAGAAGCTTTGCTCCTGATGAACAAGAACATAGATGTTTTGGAGAAAGCAGTTAAGCTGGCAGCGAAGCAGGGTGCACATATCATTGTGACCCCAGAAGATGGAATCTATGGTTGGATCTTCACCAGGGAGAGCATTTACCCCTATCTAGAGGATATACCAGACCCTGGAGTGAACTGGATTCCATGTAGAGACCCCTGGAGATTCGGCAACACACCAGTGCAACAAAGACTCAGCTGCCTGGCCAAGGACAACTCTATCTATGTCGTGGCTAATATTGGGGACAAGAAGCCATGCAATGCCAGTGACTCTCAGTGTCCCCCTGATGGCCGTTACCAATACAACACTGATGTGGTGTTTGATTCTCAGGGAAAACTGTTGGC
Ensembl | human accession no.
NCBI accession no.
shipped in
ambient
storage temp.
−20°C
Gene Information
human ... VNN3(55350) , VNN3(55350)
1 of 4
This Item | EHU003211 | EHU009221 | EHU027371 |
|---|---|---|---|
| Gene Information human ... VNN3(55350), VNN3(55350) | Gene Information human ... STYK1(55359), STYK1(55359) | Gene Information human ... COPRS(55352), C17orf79(55352) | Gene Information human ... HJURP(55355), HJURP(55355) |
| product line MISSION® | product line MISSION® | product line MISSION® | product line MISSION® |
| Ensembl | human accession no. | Ensembl | human accession no. | Ensembl | human accession no. | Ensembl | human accession no. |
| NCBI accession no. | NCBI accession no. | NCBI accession no. | NCBI accession no. |
| storage temp. −20°C | storage temp. −20°C | storage temp. −20°C | storage temp. −20°C |
General description
For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.
Legal Information
Storage Class Code
10 - Combustible liquids
Flash Point(F)
Not applicable
Flash Point(C)
Not applicable
Choose from one of the most recent versions:
Certificates of Analysis (COA)
Don't see the Right Version?
If you require a particular version, you can look up a specific certificate by the Lot or Batch number.
Already Own This Product?
Find documentation for the products that you have recently purchased in the Document Library.
Active Filters
Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.
Contact Technical Service
