Skip to Content
Merck
All Photos(1)

Key Documents

EHU061431

Sigma-Aldrich

MISSION® esiRNA

targeting human TNFRSF10B

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51
Pricing and availability is not currently available.

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GACGCTGGGAGAGAGACTTGCCAAGCAGAAGATTGAGGACCACTTGTTGAGCTCTGGAAAGTTCATGTATCTAGAAGGTAATGCAGACTCTGCCATGTCCTAAGTGTGATTCTCTTCAGGAAGTCAGACCTTCCCTGGTTTACCTTTTTTCTGGAAAAAGCCCAACTGGACTCCAGTCAGTAGGAAAGTGCCACAATTGTCACATGACCGGTACTGGAAGAAACTCTCCCATCCAACATCACCCAGTGGATGGAACATCCTGTAACTTTTCACTGCACTTGGCATTATTTTTATAAGCTGAATGTGATAATAAGGACACTATGGAAATGTCTGGATCATTCCGTTTGTGCGTACTTTGAGATTTGGTTTGGGATGTCATTGTTTTCACAGCACTTTTTTATCCTAATGTAAATGCTTTATTTATTTATTTGGGCTACATTGTAAGATCCATCTACACAGTCGTTGTCCGACTTCACTTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documents section.

If you need assistance, please contact Customer Support.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mi Hee Park et al.
Biochemical and biophysical research communications, 473(2), 586-592 (2016-04-02)
We investigated whether bakuchiol, an analog of resveratrol enhances the apoptosis ability of tumor necrosis factor (TNF)-related apoptosis-inducing ligand (TRAIL) in cancer cells. Bakuchiol enhanced expression of cell death receptor (DR) in TRAIL-sensitive and -resistant colon cancer cells in a
Su-Been Lee et al.
Biomolecules, 10(3) (2020-03-28)
Prostaglandin (PG) A2, one of cyclopentenone PGs, is known to induce activation of apoptosis in various cancer cells. Although PGA2 has been reported to cause activation of apoptosis by altering the expression of apoptosis-related genes, the role of p53, one
Fanyun Kong et al.
Virology journal, 12, 192-192 (2015-11-19)
HBV X protein (HBX) is associated with cell apoptosis mediated by TNF-α related apoptosis inducing ligand (TRAIL), while the role of HBX on the expressions of TRAIL receptors death receptor 4 (DR4) and DR5 are unclear. In this study, we
Jiping Wang et al.
Cancer biology & therapy, 20(7), 979-988 (2019-04-18)
Glioblastoma is a highly malignant and typically fatal tumor of the central nervous system. The tumor is characterized by marked cellular and molecular heterogeneity, including a subpopulation of brain tumor initiating cells (BTICs) that are highly resistant to radiation and
Cheng-Hung Chuang et al.
Chemico-biological interactions, 306, 54-61 (2019-04-09)
In the present study, we investigated the p53-independent mechanism by which quercetin (Q) increased apoptosis in human lung cancer H1299 cells exposed to trichostatin A (TSA), a histone deacetylase inhibitor. We also investigated the role of Q in increasing the acetylation

Questions

Reviews

No rating value

Active Filters

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service