Skip to Content
Merck
All Photos(1)

Key Documents

EHU047961

Sigma-Aldrich

MISSION® esiRNA

targeting human GRK2

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CATCCCTTCTCGAAGAGTGCCACTGAGCATGTCCAAGGCCACCTGGGGAAGAAGCAGGTGCCTCCGGATCTCTTCCAGCCATACATCGAAGAGATTTGTCAAAACCTCCGAGGGGACGTGTTCCAGAAATTCATTGAGAGCGATAAGTTCACACGGTTTTGCCAGTGGAAGAATGTGGAGCTCAACATCCACCTGACCATGAATGACTTCAGCGTGCATCGCATCATTGGGCGCGGGGGCTTTGGCGAGGTCTATGGGTGCCGGAAGGCTGACACAGGCAAGATGTACGCCATGAAGTGCCTGGACAAAAAGCGCATCAAGATGAAGCAGGGGGAGACCCTGGCCCTGAACGAGCGCATCATGCTCTCGCTCGTCAGCACTGGGGACTGCCCATTCATTGTCT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Choose from one of the most recent versions:

Certificates of Analysis (COA)

Lot/Batch Number

Don't see the Right Version?

If you require a particular version, you can look up a specific certificate by the Lot or Batch number.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xuezhi Yang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 110, 834-843 (2018-12-18)
CP-25 attenuates arthritis progression in animal models by inhibiting G protein-coupled receptor kinase 2 (GRK2) membrane expression. This study compared groups treated with high-dose methotrexate (MTX)/leflunomide (LEF) and CP-25 combined with low-dose MTX/LEF in an adjuvant-induced arthritis (AA) rat model
Xuezhi Yang et al.
Cells, 8(12) (2019-12-11)
Rheumatoid arthritis (RA) is characterized by the massive infiltration of various chronic inflammatory cells in synovia. In synovial fluid of patients with RA, M1 macrophages are dominant among all subtypes of macrophages, the mechanisms of macrophages polarization imbalance in RA
Jing Cheng et al.
The Journal of clinical investigation, 130(2), 1036-1051 (2020-01-22)
Antigen receptor-dependent (AgR-dependent) stimulation of the NF-κB transcription factor in lymphocytes is a required event during adaptive immune response, but dysregulated activation of this signaling pathway can lead to lymphoma. AgR stimulation promotes assembly of the CARMA1-BCL10-MALT1 complex, wherein MALT1
Jie Xu et al.
Nature communications, 8, 14002-14002 (2017-01-17)
β-TrCP and SKP2 are two well-studied F-box proteins, which often act as oncogenes. Whether and how they communicate with each other is unknown. Here we report that FBXW2, a poorly characterized F-box, is a substrate of β-TrCP1 and an E3

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service