Skip to Content
Merck
All Photos(1)

Documents

EHU038131

Sigma-Aldrich

MISSION® esiRNA

targeting human FGF9

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GAACCAGGAAAGACCACAGCCGATTTGGCATTCTGGAATTTATCAGTATAGCAGTGGGCCTGGTCAGCATTCGAGGCGTGGACAGTGGACTCTACCTCGGGATGAATGAGAAGGGGGAGCTGTATGGATCAGAAAAACTAACCCAAGAGTGTGTATTCAGAGAACAGTTCGAAGAAAACTGGTATAATACGTACTCATCAAACCTATATAAGCACGTGGACACTGGAAGGCGATACTATGTTGCATTAAATAAAGATGGGACCCCGAGAGAAGGGACTAGGACTAAACGGCACCAGAAATTCACACATTTTTTACCTAGACCAGTGGACCCCGACAAAGTACCTGAACTGTATAAGGATATTCTAAGCCAAAGTTGACAAAGACAGTTTCTTCACTTGAGCCCTTAAAAAAGTAACCACTATAAAGGTTTCACGCGGTGGGTTCTTATTGATTCGCTGTGTCATCACA

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Zhijin Zhang et al.
Experimental and therapeutic medicine, 19(3), 1711-1718 (2020-02-28)
Development of cisplatin resistance in colorectal cancer is largely caused by dysregulation of signaling pathways, including the Wnt/β-catenin signaling pathway, in cancer cells. Further investigation into the molecular mechanism of chemoresistance could improve outcomes for patients with colorectal cancer. The
Longhao Li et al.
Biology open, 9(5) (2020-05-06)
Tumor metastasis is the main contributor to high recurrence and mortality in colorectal cancer (CRC). In a previous study, we found that DJ-1 plays an important role in CRC metastasis, and is the main target in Ciclopirox olamine (CPX)-treated CRC.
Wei Wang et al.
Oncology letters, 19(1), 1001-1007 (2020-01-04)
Breast cancer has become an important public health problem. Moreover, the functions of microRNA-431 (miR-431) have been detected in human cancers other than breast cancer. Hence, we investigated the role of miR-431 in progression of breast cancer. RT-qPCR and Western

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service