Skip to Content
Merck
All Photos(1)

Documents

EHU037811

Sigma-Aldrich

MISSION® esiRNA

targeting human E2F5

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTGGCTACAGCAAAGCATCAAAAATGTGATGGACGATTCCATTAATAATAGATTAAATAATACATTTTCCTATGTAACTCATGAAGACATCTGTAATTGCTTTAATGGTGATACACTTTTGGCCATTCAGGCACCTTCTGGTACACAACTGGAGGTACCCATTCCAGAAATGGGTCAGAATGGACAAAAGAAATACCAGATCAATCTAAAGAGTCATTCAGGACCTATCCATGTGCTGCTTATAAATAAAGAGTCGAGTTCATCTAAGCCCGTGGTTTTTCCTGTTCCCCCACCTGATGACCTCACACAGCCTTCCTCCCAGTCCTTGACTCCAGTGACTCCACAGAAATCCAGCATGGCAACTCAAAATCTGCCTGAGCAACATGTCTCTGAAAGAAGCCAGGCTCTG

Ensembl | human accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Ying Liu et al.
Biochemical and biophysical research communications, 511(1), 35-40 (2019-02-16)
The MYCN oncoprotein induces the proliferation of neuroblastoma cells through regulating gene transcription. The E2F transcription factor 5 (E2F5) plays an oncogenic role in several types of cancer, however, its role in neuroblastoma cells remains poorly characterized. We report here
Yoshinori Inagaki et al.
Oncology reports, 44(5), 2241-2252 (2020-10-02)
E2F transcription factor 5 (E2F5) is a member of the E2F family of transcription factors, which are involved in regulation of various cellular processes, including cellular proliferation, apoptosis, differentiation and DNA damage response. Previously, we reported that E2F5 was aberrantly
Xiupeng Xu et al.
American journal of cancer research, 7(8), 1680-1692 (2017-09-02)
Glioblastoma multiforme (GBM) is an extraordinary aggressive disease that requires more effective therapeutic options. In the past few years, many microRNAs (miRNAs) have been demonstrated to have important roles in promoting GBM progression. However, little is known about the role

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service