Skip to Content
MilliporeSigma
All Photos(1)

Key Documents

EHU060821

Sigma-Aldrich

MISSION® esiRNA

targeting human PCSK9

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CAGGCATTCAATCCTCAGGTCTCCACCAAGGAGGCAGGATTCTTCCCATGGATAGGGGAGGGGGCGGTAGGGGCTGCAGGGACAAACATCGTTGGGGGGTGAGTGTGAAAGGTGCTGATGGCCCTCATCTCCAGCTAACTGTGGAGAAGCCCCTGGGGGCTCCCTGATTAATGGAGGCTTAGCTTTCTGGATGGCATCTAGCCAGAGGCTGGAGACAGGTGCGCCCCTGGTGGTCACAGGCTGTGCCTTGGTTTCCTGAGCCACCTTTACTCTGCTCTATGCCAGGCTGTGCTAGCAACACCCAAAGGTGGCCTGCGGGGAGCCATCACCTAGGACTGACTCGGCAGTGTGCAGTGGTGCATGCACTGTCTCAGCCAACCCGCTCCACTACCCGGCAGGGTACACATTCGCACCCCTACTTCACAGAGGAAGAAACCTGGAACCAGAGGGGGCGTGCCTGCCAAGCTCACACAGCAGGAACTGA

Ensembl | human accession no.

ENSG00000169174

NCBI accession no.

NM_174936

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... PCSK9(255738) , PCSK9(255738)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Xiaohui Xu et al.
Experimental and therapeutic medicine, 13(5), 1993-1999 (2017-06-02)
Proprotein convertase subtilisin/kexin type 9 (PCSK9) is a member of the subtilisin family of PCs that encodes a neural apoptosis-regulated convertase 1. However, the precise role of PCSK9 in lung cancer cell apoptosis has remained elusive. In the present study
Yanting Zou et al.
Inflammation, 43(1), 251-263 (2019-11-30)
Lipopolysaccharide (LPS) is demonstrated to cause "two-hit" injury to liver. Proprotein convertase subtilisin/kexin type 9 (PCSK9) plays an important role in LPS clearance. Hepatocyte nuclear factor-1 alpha (HNF-1α) and sterol regulatory element-binding protein 2 (SREBP2) were reported to be responsible
Ga Eun Lee et al.
Frontiers in endocrinology, 11, 607144-607144 (2021-01-26)
The proprotein convertase subtilisin/kexin type 9 (PCSK9) has been implicated in the pathogenesis of inflammatory diseases. We sought to investigate the role of PCSK9 in the pathogenesis of Graves' orbitopathy (GO) and whether it may be a legitimate target for
Dan Heo et al.
Nanotechnology, 26(33), 335101-335101 (2015-08-01)
The specific delivery of ribonucleic acid (RNA) interfering molecules to disease-related cells is still a critical blockade for in vivo systemic treatment. Here, this study suggests a robust delivery carrier for targeted delivery of RNA-interfering molecules using galactosylated magnetic nanovectors
Shirya Rashid et al.
Circulation, 130(5), 431-441 (2014-07-30)
Proprotein convertase subtilisin kexin type 9 (PCSK9) promotes the degradation of the low-density lipoprotein (LDL) receptor (LDLR), and its deficiency in humans results in low plasma LDL cholesterol and protection against coronary heart disease. Recent evidence indicates that PCSK9 also

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service