Skip to Content
Merck
All Photos(1)

Documents

EHU059261

Sigma-Aldrich

MISSION® esiRNA

targeting human TFEB

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCGGCAGAAGAAAGACAATCACAACTTAATTGAAAGGAGACGAAGGTTCAACATCAATGACCGCATCAAGGAGTTGGGAATGCTGATCCCCAAGGCCAATGACCTGGACGTGCGCTGGAACAAGGGCACCATCCTCAAGGCCTCTGTGGATTACATCCGGAGGATGCAGAAGGACCTGCAAAAGTCCAGGGAGCTGGAGAACCACTCTCGCCGCCTGGAGATGACCAACAAGCAGCTCTGGCTCCGTATCCAGGAGCTGGAGATGCAGGCTCGAGTGCACGGCCTCCCTACCACCTCCCCGTCCGGCATGAACATGGCTGAGCTGGCCCAGCAGGTGGTGAAGCAGGAGCTGCCTAGCGAAGAGGGCCCAGGGGAGGCCCTGATGCTGGGGGCTGAGGTCCCTGACCCTGAGCCACTGCCAGCTCTGCCCCCGCAAGCCCCGCTGCCCCTGCCCACCCAGCCACCATCCCCATTCCATCACCTGGACTTCAGCCAC

Ensembl | human accession no.

ENSG00000112561

NCBI accession no.

NM_007162

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... TFEB(7942) , TFEB(7942)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sijie Tan et al.
Scientific reports, 9(1), 727-727 (2019-01-27)
Mitochondrial dysfunction underscores aging and diseases. Mitophagy (mitochondria + autophagy) is a quality control pathway that preserves mitochondrial health by targeting damaged mitochondria for autophagic degradation. Hence, molecules or compounds that can augment mitophagy are therapeutic candidates to mitigate mitochondrial-related diseases. However
Muzo Wu et al.
American journal of physiology. Lung cellular and molecular physiology, 313(1), L138-L153 (2017-04-15)
Downregulation of the alveolar macrophage (AM) receptor with collagenous structure (MARCO) leads to susceptibility to postinfluenza bacterial pneumonia, a major cause of morbidity and mortality. We sought to determine whether immunomodulation of MARCO could improve host defense and resistance to
Li He et al.
Journal of leukocyte biology, 100(5), 1113-1124 (2016-11-02)
Macrophage dysfunction in obesity and diabetes is associated with persistent inflammation and poor wound healing responses. Relevant to these phenotypes, we have previously shown that macrophage activation in a high-fat environment results in cell death via a mechanism that involves
Raquel Parra-Millán et al.
mSphere, 3(2) (2018-03-31)
Acinetobacter baumannii is a significant human pathogen associated with hospital-acquired infections. While adhesion, an initial and important step in A. baumannii infection, is well characterized, the intracellular trafficking of this pathogen inside host cells remains poorly studied. Here, we demonstrate that
Hong-Ying Chu et al.
Cancer letters, 423, 105-112 (2018-03-11)
The role of autophagy in tongue squamous cell carcinoma (TSCC) cisplatin resistance is unclear. We aimed to identify a possible synergistic effect of autophagy inhibitors and cisplatin in TSCC cells and explore the underlying mechanism. Our results indicate that autophagic
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service