Skip to Content
Merck
All Photos(1)

Key Documents

EHU057111

Sigma-Aldrich

MISSION® esiRNA

targeting human MSH3

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCTGTGATTGATGTGTTGCTGGGAGAACAGGATCAATATGTCCCAAATAATACAGATTTATCAGAGGACTCAGAGAGAGTAATGATAATTACCGGACCAAACATGGGTGGAAAGAGCTCCTACATAAAACAAGTTGCATTGATTACCATCATGGCTCAGATTGGCTCCTATGTTCCTGCAGAAGAAGCGACAATTGGGATTGTGGATGGCATTTTCACAAGGATGGGTGCTGCAGACAATATATATAAAGGACAGAGTACATTTATGGAAGAACTGACTGACACAGCAGAAATAATCAGAAAAGCAACATCACAGTCCTTGGTTATCTTGGATGAACTAGGAAGAGGGACGAGCACTCATGATGGAATTGCCATTGCCTATGCTACACTTGAGTATTTCATCAGAGATGTGAAATCCTTAACCCTGTTTGTCACCCATTATCCGC

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Sarah J Young et al.
Cell reports, 33(3), 108289-108289 (2020-10-22)
MutSα and MutSβ play important roles in DNA mismatch repair and are linked to inheritable cancers and degenerative disorders. Here, we show that MSH2 and MSH3, the two components of MutSβ, bind SLX4 protein, a scaffold for the assembly of
Daniel J McGrail et al.
Cancer cell, 37(3), 371-386 (2020-02-29)
Deficient DNA mismatch repair (dMMR) induces a hypermutator phenotype that can lead to tumorigenesis; however, the functional impact of the high mutation burden resulting from this phenotype remains poorly explored. Here, we demonstrate that dMMR-induced destabilizing mutations lead to proteome
Yan Li et al.
Journal of molecular histology, 46(4-5), 357-364 (2015-06-21)
Multidrug resistance-associated protein 1 (MRP1) belongs to ATP-binding cassette transporters family. The overexpression of MRP1 is predominantly related with the failure of chemo-radiotherapy in various tumors. However, its possible role in hypertrophic scar (HS) is hardly investigated. Here we showed

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service