Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EMU047141

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Il1rl1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

ATTGCCTGTTCAGCTTGCTTTGGCAAAGGCTCTCACTTCTTGGCTGATGTCCTGTGGCAGATTAACAAAACAGTAGTTGGAAATTTTGGTGAAGCAAGAATTCAAGAAGAGGAAGGTCGAAATGAAAGTTCCAGCAATGACATGGATTGTTTAACCTCAGTGTTAAGGATAACTGGTGTGACAGAAAAGGACCTGTCCCTGGAATATGACTGTCTGGCCCTGAACCTTCATGGCATGATAAGGCACACCATAAGACTGAGAAGGAAACAACCAAGTAAGGAGTGTCCCTCACACATTGCTTGAATAAATTGGCTGAATCAGCTGTGCACTGCATCCGTTTTCTCCGAGGACTGTGTGTTGTAGCTTGGTCCCAGGGAATCCATCATGATCAAGGGAATAGTTGGCCTG

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xi-Xiang Yu et al.
Digestive diseases and sciences, 60(5), 1265-1272 (2015-02-07)
As a pro-inflammatory cytokine, IL-33 has been demonstrated to play an important role in tumor progression. It is reported that IL-33 is highly expressed in the serum and tumor tissues of patients with gastric cancer. However, the function of IL-33
S Stojkovic et al.
Journal of thrombosis and haemostasis : JTH, 12(6), 948-957 (2014-04-08)
Urokinase-type plasminogen activator (u-PA) plays a pivotal role in extracellular proteolysis and is thought to be critically involved in the modulation of angiogenesis. Interleukin (IL)-33 is a member of the IL-1 cytokine family, which is thought to act as danger
Anne Marie Thompson et al.
American journal of physiology. Heart and circulatory physiology, 307(4), H533-H541 (2014-06-29)
Loss of vascular smooth muscle cell (VSMC) function is a hallmark of vascular disease. VSMCs become increasingly dysregulated, apoptotic, and senescent as we age. Sirtuin 1 (SirT1) is a deactylase that regulates substrates associated with stress mitigation, metabolism, and aging.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico