Saltar al contenido

We are planning system maintenance on January 25, 2025, from 1:00 PM to 4:00 PM CST. This will impact both web and offline transactions, including online orders, quotes, price and availability checks, and order status inquiries. We apologize for any inconvenience.

Merck

EHU114351

Sigma-Aldrich

MISSION® esiRNA

targeting human PTRH2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

En este momento no podemos mostrarle ni los precios ni la disponibilidad

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GCAAGACGAGCAAGACACACACAGATACTGAAAGTGAAGCAAGCATCTTGGGAGACAGCGGGGAGTACAAGATGATTCTTGTGGTTCGAAATGACTTAAAGATGGGAAAAGGGAAAGTGGCTGCCCAGTGCTCTCATGCTGCTGTTTCAGCCTACAAGCAGATTCAAAGAAGAAATCCTGAAATGCTCAAACAATGGGAATACTGTGGCCAGCCCAAGGTGGTGGTCAAAGCTCCTGATGAAGAAACCCTGATTGCATTATTGGCCCATGCAAAAATGCTGGGACTGACTGTAAGTTTAATTCAAGATGCTGGACGTACTCAGATTGCACCAGGCTCTCAAACTGTCCTAGGGATTGGGCCAGGACCAGCAGACCTAATTGACAAAGTCACTGGTCACCTAAAACTTTACTAGGTGGACTTTGATATGACAACAACCCCTCCATCACAAG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yan Liu et al.
Human cell, 32(4), 418-427 (2019-08-02)
Studies have shown that astrocyte plays an important role in the formation of retinal vasculature during development. For our study, we investigated the role of Bcl2 inhibitor of transcription 1 (Bit1) in regulating astrocyte function from developing retina and its
Xin Yao et al.
PloS one, 9(7), e101564-e101564 (2014-07-09)
The mitochondrial Bit1 (Bcl-2 inhibitor of transcription 1) protein is a part of an apoptotic pathway that is uniquely regulated by integrin-mediated attachment. As an anoikis effector, Bit1 is released into the cytoplasm following loss of cell attachment and induces

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico