Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU057101

Sigma-Aldrich

MISSION® esiRNA

targeting human PINK1, PINK1-AS

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CTGGAGTGTGAAACGCTCTGCCAGGCAGCCCTCCTCCTCTGCTCATGGAGGGCAGCCCTGTGATGTCCCTGCATGGAGCTGGTGAATTACTAAAAGAACATGGCATCCTCTGTGTCGTGATGGTCTGTGAATGGTGAGGGTGGGAGTCAGGAGACAAGACAGCGCAGAGAGGGCTGGTTAGCCGGAAAAGGCCTCGGGCTTGGCAAATGGAAGAACTTGAGTGAGAGTTCAGTCTGCAGTCCTCTGCTCACAGACATCTGAAAAGTGAATGGCCAAGCTGGTCTAGTAGATGAGGCTGGACTGAGGAGGGGTAGGCCTGCATCCACAGAGAGGATCCAGGCCAAGGCACTGGCTGTCAGTGGCAGAGTTTGGCTGTGACCTTTGCCCCTAACACGAGGAACTCGTTTGAAGGGGGCAGCGTAGCATGTCTGATTTGCCACCTGGAT

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

C-N Yang et al.
International endodontic journal, 52(5), 676-688 (2018-12-12)
To assess the connection between mitophagy and hypoxia-induced apoptosis in osteoblasts and whether simvastatin alleviates bone resorption in apical periodontitis through modulation of mitophagy-related apoptosis. Hypoxia-induced generation of reactive oxygen species in mitochondria and changes in mitochondrial membrane potential were
Yuan Xu et al.
Molecular neurobiology, 56(1), 252-266 (2018-04-25)
There is emerging evidence suggesting that neurotoxic insults and hypoxic/ischemic injury are underlying causes of Parkinson's disease (PD). Since PTEN-induced kinase 1 (PINK1) dysfunction is involved in the molecular genesis of PD and since our recent studies have demonstrated that
Rachel M Furlong et al.
Neuroscience letters, 720, 134777-134777 (2020-01-25)
Accumulation of α-synuclein is a pathological hallmark of Parkinson's disease (PD) and has been linked to reductions in neurite length and axonal degeneration of midbrain dopaminergic neurons. Mutations in SNCA, which encodes α-synuclein, and loss of function mutations in PTEN-induced putative
Yan Gao et al.
Biochemical pharmacology, 177, 113997-113997 (2020-05-01)
Alzheimer's disease (AD) is an irreversible neurodegenerative brain disorder with complex pathogenesis. The fibrillar peptide β-amyloid (Aβ) has a chief function in the pathogenesis of AD. Emerging evidence has indicated that there is a tight relationship between inflammation, mitochondrial dysfunction
Ruru Li et al.
Oxidative medicine and cellular longevity, 2019, 9341018-9341018 (2019-10-05)
Parkinson's disease (PD) is a common neurodegenerative disease characterized by the degeneration of nigrostriatal dopaminergic (DA) neurons. Our previous studies have suggested that salidroside (Sal) might play neuroprotective effects against PD by preserving mitochondrial Complex I activity. However, the exact

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico