Saltar al contenido
Merck
Todas las fotos(1)

Documentos clave

EHU056991

Sigma-Aldrich

MISSION® esiRNA

targeting human CLOCK

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGCACACATAGGCCATCTTATGAAGATAGAGTTTGTTTTGTAGCTACTGTCAGGTTAGCTACACCTCAGTTCATCAAGGAAATGTGCACTGTTGAAGAACCCAATGAAGAGTTTACATCTAGACATAGTTTAGAATGGAAGTTTCTGTTTCTAGATCACAGGGCACCACCCATAATAGGGTATTTGCCATTTGAAGTTCTGGGAACATCAGGCTATGATTACTATCATGTGGATGACCTAGAAAATTTGGCAAAATGTCATGAGCACTTAATGCAATATGGGAAAGGCAAATCATGTTATTATAGGTTCCTGACTAAGGGGCAACAGTGGATTTGGCTTCAGACTCATTATTATATCACTTACCATCAGTGGAATTCAAGGCCAGAGTTTATTGTTTGTACTCACACTGTAGTAAGTTATGCAGAAGTTAGGGCTGAAAGACGACG

Ensembl | nº de acceso humano

ENSG00000134852

Nº de acceso NCBI

NM_004898

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... CLOCK(9575) , CLOCK(9575)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
WNS
JRR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Pan Jiang et al.
International journal of molecular medicine, 46(6), 2216-2224 (2020-10-31)
Circadian rhythm plays an important role in diverse physiological processes. Abnormal expression of circadian rhythm genes is associated with increased risk of disease, including different types of cancer. The cancer stem cell (CSC) hypothesis suggests that there is a small
Qixia Jiang et al.
Acta biochimica et biophysica Sinica, 50(9), 869-879 (2018-08-21)
To explore the association between clock circadian regulator circadian locomotor output cycles kaput gene (CLOCK) and the forming of atherosclerotic plaques and its underlying mechanisms, mouse aortic endothelial cells (MAECs) and atherosclerosis (AS) mouse model were recruited for our study.
Soon Young Shin et al.
Scientific reports, 7(1), 11175-11175 (2017-09-13)
The juice of Ageratum houstonianum is used in folk medicine as an external wound healing aid for skin injuries. However, the active component of A. houstonianum and its mode of action in skin wound healing has not been investigated. This
Ursula Loizides-Mangold et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(41), E8565-E8574 (2017-10-05)
Circadian clocks play an important role in lipid homeostasis, with impact on various metabolic diseases. Due to the central role of skeletal muscle in whole-body metabolism, we aimed at studying muscle lipid profiles in a temporal manner. Moreover, it has
Laurent Perrin et al.
eLife, 7 (2018-04-17)
Circadian regulation of transcriptional processes has a broad impact on cell metabolism. Here, we compared the diurnal transcriptome of human skeletal muscle conducted on serial muscle biopsies in vivo with profiles of human skeletal myotubes synchronized in vitro. More extensive

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico