Skip to Content
Merck
All Photos(1)

Key Documents

EHU053481

Sigma-Aldrich

MISSION® esiRNA

targeting human CDK9

Sign Into View Organizational & Contract Pricing


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TACGAGAAGCTCGCCAAGATCGGCCAAGGCACCTTCGGGGAGGTGTTCAAGGCCAGGCACCGCAAGACCGGCCAGAAGGTGGCTCTGAAGAAGGTGCTGATGGAAAACGAGAAGGAGGGGTTCCCCATTACAGCCTTGCGGGAGATCAAGATCCTTCAGCTTCTAAAACACGAGAATGTGGTCAACTTGATTGAGATTTGTCGAACCAAAGCTTCCCCCTATAACCGCTGCAAGGGTAGTATATACCTGGTGTTCGACTTCTGCGAGCATGACCTTGCTGGGCTGTTGAGCAATGTTTTGGTCAAGTTCACGCTGTCTGAGATCAAGAGGGTGATGCAGATGCTGCTTAACGGCCTCTACTACATCCACAGAAACAAGATCCTGCATAGGGACATGAAGGCTGCTAATGTGCTTATCACTCGTGATGGGGTCCTGAAGCTGGCAGACTTT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable


Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Jinglu Wang et al.
FASEB journal : official publication of the Federation of American Societies for Experimental Biology, 33(5), 5990-6000 (2019-02-07)
Despite surgical and chemotherapeutic advances over the past few decades, the prognosis for ovarian cancer remains very poor. Although cyclin-dependent kinase (CDK) 9 has an established pathogenic role in various cancers, its function in ovarian cancer remains poorly defined. The
Xiaoyang Li et al.
Journal of orthopaedic research : official publication of the Orthopaedic Research Society, 37(2), 510-521 (2018-11-30)
Synovial sarcomas hold a low genomic complexity, making it distinct from other types of soft-tissue sarcomas. Many studies focused on targeting the SS18-SSX fusion protein, which presents in over 90% of human synovial sarcomas. This protein acts as an oncogenic
Nicole Pinto et al.
PloS one, 15(9), e0239315-e0239315 (2020-09-25)
Anaplastic thyroid cancer (ATC) is a rare, but nearly uniformly fatal disease that is typically resistant to chemotherapy and radiation. Alternative strategies to target this cancer at a molecular level are necessary in order to improve dismal outcomes for ATC
Hangzhan Ma et al.
EBioMedicine, 39, 182-193 (2018-12-24)
Cyclin-dependent protein kinase 9 (CDK9) has been shown to play an important role in the pathogenesis of malignant tumors. However, the expression and function of CDK9 remain unknown in osteosarcomas. The purpose of this study is to assess the expression
Shasha He et al.
Oncology reports, 44(5), 1929-1938 (2020-09-10)
Endometrial cancer is one of the three major malignant tumors of the female reproductive system. Although cyclin‑dependent kinase 9 (CDK9) has a definitive pathogenic role in various types of cancer, little is known concerning its function in endometrial cancer. Our

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service