Skip to Content
Merck
All Photos(1)

Key Documents

EHU144011

Sigma-Aldrich

MISSION® esiRNA

targeting human APEX1

Sign Into View Organizational & Contract Pricing
All Photos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CCCCAGATCAGAAAACCTCACCCAGTGGCAAACCTGCCACACTCAAGATCTGCTCTTGGAATGTGGATGGGCTTCGAGCCTGGATTAAGAAGAAAGGATTAGATTGGGTAAAGGAAGAAGCCCCAGATATACTGTGCCTTCAAGAGACCAAATGTTCAGAGAACAAACTACCAGCTGAACTTCAGGAGCTGCCTGGACTCTCTCATCAATACTGGTCAGCTCCTTCGGACAAGGAAGGGTACAGTGGCGTGGGCCTGCTTTCCCGCCAGTGCCCACTCAAAGTTTCTTACGGCATAGGCGATGAGGAGCATGATCAGGAAGGCCGGGTGATTGTGGCTGAATTTGACTCGTTTGTGCTGGTAACAGCATATGTACCTAATGCAGGCCGAGGTCTGGTACGACTGGAGTACCGGCAGCGCTGGGATGAAGCCTTTCGCAAGTTCCTGAAGGGCCTGGCTTCCCGAAAGCCCCTTGTGCTGTGTGGAGACCTC

Ensembl | human accession no.

ENSG00000100823

NCBI accession no.

NM_001641

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... APEX1(328) , APEX1(328)

Related Categories

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class Code

10 - Combustible liquids

Flash Point(F)

Not applicable

Flash Point(C)

Not applicable

Certificates of Analysis (COA)

Search for Certificates of Analysis (COA) by entering the products Lot/Batch Number. Lot and Batch Numbers can be found on a product’s label following the words ‘Lot’ or ‘Batch’.

Already Own This Product?

Find documentation for the products that you have recently purchased in the Document Library.

Visit the Document Library

Mengxia Li et al.
Nucleic acids research, 46(11), 5664-5677 (2018-05-12)
Base excision repair (BER) handles many forms of endogenous DNA damage, and apurinic/apyrimidinic endonuclease 1 (APE1) is central to this process. Deletion of both alleles of APE1 (a.k.a. Apex1) in mice leads to embryonic lethality, and deficiency in cells can
Aaron M Fleming et al.
Proceedings of the National Academy of Sciences of the United States of America, 114(10), 2604-2609 (2017-02-02)
Reactive oxygen species (ROS) have emerged as important cellular-signaling agents for cellular survival. Herein, we demonstrate that ROS-mediated oxidation of DNA to yield 8-oxo-7,8-dihydroguanine (OG) in gene promoters is a signaling agent for gene activation. Enhanced gene expression occurs when
Shu-Ting Pan et al.
BMC cancer, 20(1), 634-634 (2020-07-10)
Drug resistance is a major cause of therapeutic failure that is often associated with elevated autophagy and apurinic/apyrimidinic endonuclease 1 (APE1) expression. Herein, we investigated the role of APE1 and autophagy in A549 cells treated with cisplatin. SILAC proteomics was
Nasrin Akhter et al.
The Journal of biological chemistry, 291(45), 23672-23680 (2016-09-18)
Apurinic/apyrimidinic endonuclease 1/redox factor-1 (Ape1/Ref-1) is a multifunctional protein possessing DNA repair, redox control, and transcriptional regulatory activities. Although Ape1/Ref-1 plays multiple roles in the immune system, its functions in helper T (Th) cell activation and differentiation are largely unknown.
Giulia Antoniali et al.
Nature communications, 8(1), 797-797 (2017-10-08)
Mammalian apurinic/apyrimidinic endonuclease 1 is a DNA repair enzyme involved in genome stability and expression of genes involved in oxidative stress responses, tumor progression and chemoresistance. However, the molecular mechanisms underlying the role of apurinic/apyrimidinic endonuclease 1 in these processes
View All Related Papers

Our team of scientists has experience in all areas of research including Life Science, Material Science, Chemical Synthesis, Chromatography, Analytical and many others.

Contact Technical Service