HMI0001
MISSION® microRNA Mimic
hsa-let-7a
Sinónimos:
Mature Sequence: UGAGGUAGUAGGUUGUAUAGUU, hsa-let-7a-5p
Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
About This Item
Productos recomendados
Línea del producto
MISSION®
Formulario
solid
Nº de acceso Sanger mature/minor
Nº de acceso Sanger microRNA
temp. de almacenamiento
−20°C
Información sobre el gen
Descripción general
The ready-to-use MISSION miRNA mimics are small, double-stranded RNA molecules designed to mimic endogenous mature miRNA molecules when introduced into cells. miRNA are known to regulate gene expression in a variety of manners, including translational repression, mRNA cleavage and deadenylation. MISSION miRNA Mimics, a member of MISSION RNAi product family, provides miRNA researchers with a range of options from individual MISSION mimics to a full library of human miRNA mimics based on latest version of miRBase (currently hosted by the University of Manchester, previously hosted by the Sanger Institute).
- Optimized and ready for transfection.
- Novel MISSION miRNA mimic design has been functionally tested for knockdown efficiency against natural miRNA targets.
- Unique MISSION miRNA mimic design significantly reduces possible sense strand off target effects.
- Available as a whole human library and individual miRNA targets.
Otras notas
miRBase V18 Mature ID update: hsa-let-7a-5p
Información legal
MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany
Código de clase de almacenamiento
11 - Combustible Solids
Clase de riesgo para el agua (WGK)
WGK 3
Punto de inflamabilidad (°F)
Not applicable
Punto de inflamabilidad (°C)
Not applicable
Elija entre una de las versiones más recientes:
Certificados de análisis (COA)
Lot/Batch Number
It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.
Si necesita más asistencia, póngase en contacto con Atención al cliente
¿Ya tiene este producto?
Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.
Shubhangini Kataruka et al.
Nucleic acids research, 48(14), 8050-8062 (2020-07-02)
MicroRNAs (miRNAs) are ubiquitous small RNAs guiding post-transcriptional gene repression in countless biological processes. However, the miRNA pathway in mouse oocytes appears inactive and dispensable for development. We propose that marginalization of the miRNA pathway activity stems from the constraints
Active Filters
Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.
Póngase en contacto con el Servicio técnico
