Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EMU201271

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Pcsk6

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGATTAGCCAAAAGACATCTGATGGCCAGGCAGTTCCATAAACATGCAAAGCCAGCCCCTGAATCACTAGTCGCCAGCCCTCCATGGCACACAACTGCTTTTCAAGTGTATTTGGCCTCTGCACTCGGGACTCTCTGTTCTTGGGTGGATGCTGCGCTGGTCCAGTATGGTACAAGCCTACATGATAGAGCTGGATTGATTTTTCTGCCAAGCCTGTGTGGGCATTTTATAAGCTACGTGTTCTAATTTTTACCGATGTTAATTATTTTGACAAATATTTCATATATTTTCATTGAAATGCGCAAATCCGCTTGCTCAGTTCCCTGAGCTAAGGGAATAACACTTGCCTTAAATTTCCCCAACCTCGTCTCTCTCCACATGGTCCTGCTCTCCTCTCTGACTGTAATGTGTTTGTCTTGTCACCTGTAGGTGGCAAGGACTCAGCTGTTGTCTGTTGAATCCACACTTCAAATAAGAAATCAGTGAAGCAAATCTAATGTTAACCCTGA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jian Fu et al.
Molecular carcinogenesis, 54(9), 698-706 (2014-01-18)
Proprotein convertases (PC), a family of serine proteases, process cancer-related substrates such as growth factors, growth factor receptors, cell adhesion molecules, metalloproteinases, etc. HIF-1α is a major transcription factor involved in tumorigenesis by sensing intratumoral hypoxia. Furin (PCSK3) is one
Zhiyong Yao et al.
Drug design, development and therapy, 9, 5911-5923 (2015-11-26)
PACE4 is a proprotein convertase capable of processing numerous substrates involved in tumor growth, invasion, and metastasis. However, the precise role of PACE4 during prostate cancer cell apoptosis has not been reported. In the present study, human prostate cancer cell
Huiyu Jiang et al.
Molecular medicine reports, 12(5), 7681-7686 (2015-10-16)
The aim of the present study was to assess the effects of pro-protein convertase subtilisin/kexin type 6 (PCSK6), a proteinase implicated in the proteolytic activity of various precursor proteins and involved in the regulation of protein maturation, in fibroblast‑like synoviocytes

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico