Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU180041

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Mll1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCAGCTCTGCAAGATTGAGAAGAGTAAGAGTCTCAAACAGACTGACCAGCCCAAAGCACAGGGTCAAGAAAGTGATTCATCAGAAACCTCTGTTCGAGGACCCCGGATTAAACATGTCTGCAGAAGAGCTGCTGTTGCCCTTGGCCGCAAACGAGCTGTGTTTCCTGATGACATGCCCACCTTGAGTGCCTTACCGTGGGAAGAACGAGAAAAAATTTTGTCTTCCATGGGGAATGATGACAAGTCATCAGTTGCTGGCTCAGAAGATGCCGAGCCTCTTGCTCCTCCCATCAAACCAATTAAGCCTGTCACCAGAAACAAGGCACCTCAGGAGCCTCCGGTGAAGAAAGGGCGGCGATCAAGGCGGTGCGGACAATGTCCTGGCTGCCAGGTGCCTGAGGACTGTGGCATTTGCACTAATTGCCTGGACAAGCCCAAGTTTGGTGGCCGCAATATAAAGAAGCAATGCTGCAAGATGAGGAAATGTCAGAATCTGCAGTGGATGCCTTC

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Gregory C Addicks et al.
Nature communications, 10(1), 4256-4256 (2019-09-20)
PAX7 is a paired-homeobox transcription factor that specifies the myogenic identity of muscle stem cells and acts as a nodal factor by stimulating proliferation while inhibiting differentiation. We previously found that PAX7 recruits the H3K4 methyltransferases MLL1/2 to epigenetically activate
Yong-Sun Maeng et al.
BMC medical genomics, 8, 74-74 (2015-11-11)
TGFβ1-induced expression of transforming growth factor β-induced protein (TGFBIp) and extracellular matrix (ECM) genes plays a major role in the development of granular corneal dystrophy type 2 (GCD2: also called Avellino corneal dystrophy). Although some key transcription factors are known

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico