Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU150591

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gulo

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CATCTCCACGAGCCATACATAAACTACAATCATCTCAGGAAAAGGGGTTCCCCTTGCATCATATCTGTCCAGGCTAAGGATTTGGTCCTTCTAGGTTCTACTGGTCCACCAAGTATAGAGAGATCCCTGGGGCCTGCAGTTTTCCCTCCCTCTTCAGAAGGGATCTCTTGGCAACAGAGGTAGCATGAGGCATGCTCTGCTTACTTTTATCCTTAAAGGCCTTTCAGATGCCCAGAGTCTGTCTGTTGGTCCTGAGCAAGCCATCTTCCAGATGGGTCCACGTGGCCTTCTGACTGCCATGGCCTGGCCCTCACAGTGTCTCTTTCGGGTGGTGTTTAGAGTGGAATTTGCCTCGTCTTCTTAACCAGTTCCTGTTAGATCCCTGTGTTTTCTCCCTTCACCTCAGAGACAATTCTTTGGGCTGGGATCTCGCCGTGTCCCTGGGTTTCCCTGGGTCTTGGTTTCATCTTTCTCTTCACAGAGATGATTTCAGTTTATTTGTGGCCTTTCTGGAATGT

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Anke Nijhuis et al.
Clinical science (London, England : 1979), 127(5), 341-350 (2014-03-20)
Intestinal fibrosis with stricture formation is a complication of CD (Crohn's disease) that may mandate surgical resection. Accurate biomarkers that reflect the relative contribution of fibrosis to an individual stricture are an unmet need in managing patients with CD. The
Quentin Lepiller et al.
Journal of innate immunity, 7(5), 530-544 (2015-03-21)
In patients with hepatitis C virus (HCV) infection, enhanced activity of indoleamine-2,3-dioxygenase 1 (IDO) has been reported. IDO - a tryptophan-catabolizing enzyme - has been considered as both an innate defence mechanism and an important regulator of the immune response.
Norbert Braun et al.
Scientific reports, 5, 13450-13450 (2015-08-26)
Tumor cells can adapt to a hostile environment with reduced oxygen supply. The present study aimed to identify mechanisms that confer hypoxia resistance. Partially hypoxia/reoxygenation (H/R)-resistant proximal tubular (PT) cells were selected by exposing PT cultures to repetitive cycles of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico