Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU092761

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Psmd2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGCTCTCAAGTGGATTCTGCACGAATGAACCTAGCCTCCTCTTTTGTAAATGGCTTTGTGAATGCAGCCTTTGGTCAAGATAAACTACTGACTGATGATGGCAACAAATGGCTTTACAAGAACAAGGACCATGGGATGCTAAGTGCTGCTGCGTCTCTTGGCATGATTCTGCTGTGGGATGTGGATGGTGGCCTCACCCAGATTGACAAGTATCTGTACTCCTCTGAGGACTACATCAAGTCAGGAGCTCTCCTTGCCTGTGGTATCGTGAATTCTGGAGTCCGGAATGAGTGTGATCCTGCCCTGGCACTGCTTTCAGACTATGTTCTCCATAACAGCAATACCATGAGACTTGGCTCCATCTTTGGGCTAGGTTTGGCCTATGCTGGCTCTAATCGGGAAGATGTTCTAACACTGCTGCTACCTGTAATGGGAGATTCCAAGTCCAGCATGGAGGTGGCAGGTGTGACGGCTCTAGCTTGTGGGATGATAGCAGTGGGGTCCTG

Ensembl | nº de acceso | ratón

ENSMUSG00000006998

Nº de acceso NCBI

NM_134101

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... PSMD2(21762) , Psmd2(21762)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
QCS

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Christoph Gerhardt et al.
The Journal of cell biology, 210(1), 115-133 (2015-07-08)
Mutations in RPGRIP1L result in severe human diseases called ciliopathies. To unravel the molecular function of RPGRIP1L, we analyzed Rpgrip1l(-/-) mouse embryos, which display a ciliopathy phenotype and die, at the latest, around birth. In these embryos, cilia-mediated signaling was
Peter Tsvetkov et al.
eLife, 4 (2015-09-04)
Proteasomes are central regulators of protein homeostasis in eukaryotes. Proteasome function is vulnerable to environmental insults, cellular protein imbalance and targeted pharmaceuticals. Yet, mechanisms that cells deploy to counteract inhibition of this central regulator are little understood. To find such

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico