Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU085451

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdk2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGATTGGAGAGGGCACGTACGGAGTGGTGTACAAAGCCAAAAACAAGTTGACGGGAGAAGTTGTGGCGCTTAAGAAGATCCGGCTCGACACTGAGACTGAAGGTGTACCCAGTACTGCCATCCGAGAGATCTCTCTCCTTAAGGAACTTAATCACCCTAATATCGTCAAGCTGCTGGATGTCATCCACACAGAAAATAAGCTTTATCTGGTTTTTGAATTTCTGCACCAGGACCTCAAGAAATTCATGGATGCCTCTGCTCTCACGGGCATTCCTCTTCCCCTCATCAAGAGCTATCTGTTCCAGCTGCTCCAGGGCCTGGCTTTCTGCCATTCTCACCGTGTCCTTCACCGAGACCTTAAGCCCCAGAACCTGCTTATCAATGCAGAGGGGTCCATCAAGCTGGCAGACTTTGGACTAGCAAGAGCCTTTGGAGTCCCTGTCCGAACTTACACTCATGAGGTGGTGACCCTGTGGTACCGAGCACCTGAAATTCTTCTGGGCTGC

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Takeshi Namiki et al.
Cancer research, 75(13), 2708-2715 (2015-04-03)
The AMPK-related kinase NUAK2 has been implicated in melanoma growth and survival outcomes, but its therapeutic utility has yet to be confirmed. In this study, we show how its genetic amplification in PTEN-deficient melanomas may rationalize the use of CDK2
Narisa Chan et al.
Scientific reports, 5, 11777-11777 (2015-07-01)
The cytoplasmic mutant of nucleophosmin (NPMc) is found approximately in one-third of acute myeloid leukemia (AML) cases and is highly associated with normal karyotype. Whereas previous studies have focused on wtNPM in centrosome duplication, we further elucidate the role of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico