Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU083541

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Lpl

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AGGTGGACATCGGAGAACTGCTCATGATGAAGCTTAAGTGGATGAGCGACTCCTACTTCAGCTGGCCCGACTGGTGGAGCAGCCCCAGCTTCGTCATCGAGAGGATCCGAGTGAAAGCCGGAGAGACTCAGAAAAAGGTCATCTTCTGTGCTAGGGAGAAAGTTTCTCATCTGCAGAAGGGAAAGGACTCAGCAGTGTTTGTGAAATGCCATGACAAGTCTCTGAAGAAGTCTGGCTGACACTGGACAAACAAACAAGAGAAGAAAGCATCCGAGTTCTTTGAAGACAGAAGAAAACAAAGTAAATTTAATTTAAAAAAATAATACCCTTGTTTGGGTGTTTGAAAGTGGGTTTTCCTGAGTATTAATCCCAGCTCTATCTTGTTAGTTAAACAGAAGACAGTCTCAAATATTAAACGGTGGCTAACCCAGGGTGAGGAATCTAATGGCCCATAGCAGGTCTTCCAGCATCAGAAGACATCAGGCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Majib Jan et al.
Biochemical and biophysical research communications, 462(1), 33-37 (2015-05-02)
In previous studies, we demonstrated that down-regulation of lipoprotein lipase in L6 muscle cells increased insulin-stimulated glucose uptake. In the current study, we used RNA interference technology to silence the LPL gene in L6 cells and generate a LPL-knock-down (LPL-KD)
Ping-Ping He et al.
Biochimie, 106, 81-90 (2014-08-26)
Accumulating evidence suggests that microRNA-590 (miR-590) has protective effects on cardiovascular diseases, but the mechanism is unknown. Interestingly, previous studies from our laboratory and others have shown that macrophage-derived lipoprotein lipase (LPL) might accelerate atherosclerosis by promoting lipid accumulation and
Uri Rozovski et al.
Molecular cancer research : MCR, 13(5), 944-953 (2015-03-04)
While reviewing chronic lymphocytic leukemia (CLL) bone marrow slides, we identified cytoplasmic lipid vacuoles in CLL cells but not in normal B cells. Because lipoprotein lipase (LPL), which catalyzes hydrolysis of triglycerides into free fatty acids (FFA), is aberrantly expressed

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico