Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU071351

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Src

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ACGAGGAAGGTGGATGTCAGAGAGGGAGACTGGTGGCTGGCACACTCGCTGAGCACGGGACAGACCGGTTACATCCCCAGCAACTATGTGGCGCCCTCCGACTCCATCCAGGCTGAGGAGTGGTACTTTGGCAAGATCACTAGACGGGAATCAGAGCGGCTGCTGCTCAACGCCGAGAACCCGAGAGGGACCTTCCTCGTGAGGGAGAGTGAGACCACAAAAGGTGCCTACTGCCTCTCTGTATCCGACTTCGACAATGCCAAGGGCCTAAATGTGAAACACTACAAGATCCGCAAGCTGGACAGCGGCGGTTTCTACATCACCTCCCGCACCCAGTTCAACAGCCTGCAGCAGCTCGTGGCTTACTACTCCAAACATGCTGATGGCCTGTGTCACCGCCTCACTACCGTATGTCCCACATCCAAGCCT

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

12 - Non Combustible Liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiaohua Guo et al.
PloS one, 15(4), e0231739-e0231739 (2020-05-01)
We previously reported microvascular leakage resulting from fibrinogen-γ chain C-terminal products (γC) occurred via a RhoA-dependent mechanism. The objective of this study was to further elucidate the signaling mechanism by which γC induces endothelial hyperpermeability. Since it is known that
Nan Wang et al.
PloS one, 9(8), e105570-e105570 (2014-08-21)
SRC, also known as proto-oncogene c-Src, is a non-receptor tyrosine kinase that plays an important role in cancer progression by promoting survival, angiogenesis, proliferation, and invasion pathways. In this study, we found that SRC protein levels were consistently upregulated in
Beiping Miao et al.
International journal of cancer, 147(1), 189-201 (2019-12-18)
Binding of transcription factors to mutated DNA sequences is a likely regulator of cancer progression. Noncoding regulatory mutations such as those on the core promoter of the gene encoding human telomerase reverse transcriptase have been shown to affect gene expression
Guang-Ning Yan et al.
Oncotarget, 8(49), 85628-85641 (2017-11-22)
Osteosarcoma is the most common type of bone cancer, and the second leading cause of cancer-related death in children and young adults. Osteosarcoma stem cells are essential for osteosarcoma initiation, metastasis, chemoresistance and recurrence. In the present study, we report
M Katie Conley-LaComb et al.
Molecular cancer, 15(1), 68-68 (2016-11-05)
The CXCL12/CXCR4 axis transactivates HER2 and promotes intraosseous tumor growth. To further explore the transactivation of HER2 by CXCL12, we investigated the role of small GTP protein G We used a variety of methods such as lipid raft isolation, invasion

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico