Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU067621

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Brd2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTCCCCAGCTAGTCCTCCTGGGAGTCTTGAGCCAAAGGCAGCAAGGCTCCCTCCTATGCGCAGAGAGAGTGGCCGCCCAATCAAACCCCCACGAAAAGACTTGCCTGACTCGCAACAGCAACACCAGAGCTCTAAGAAAGGGAAGCTGTCAGAGCAGTTAAAGCACTGCAACGGCATCCTGAAGGAACTGCTCTCAAAGAAGCACGCTGCCTACGCCTGGCCCTTCTATAAGCCAGTGGACGCTTCTGCTCTTGGCCTTCATGATTACCATGACATCATTAAACACCCCATGGACCTCAGCACTGTCAAGCGGAAGATGGAGAACCGTGACTACCGGGATGCACAGGAGTTTGCTGCTGATGTACGGCTTATGTTCTCCAACTGCTATAAGTACAATCCTCCAGACCACGATGTTGTG

Ensembl | mouse accession no.

ENSMUSG00000024335

NCBI accession no.

NM_001025387

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... BRD2(14312) , Brd2(14312)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

12 - Non Combustible Liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Kun Zang et al.
PloS one, 8(10), e78536-e78536 (2013-11-07)
Bromodomain-containing protein 2 (Brd2) is a nuclear serine/threonine kinase involved in transcriptional regulation. In 3T3-L1 adipocytes, Brd2 normally co-represses PPARγ (peroxisome proliferator-activated receptor gamma) and inhibits adipogenesis. Here, we show that Brd2 over-expression in preadipocytes inhibits their differentiation into adipocytes
Chiara Pastori et al.
Epigenetics, 9(4), 611-620 (2014-02-06)
Epigenetic proteins have recently emerged as novel anticancer targets. Among these, bromodomain and extra terminal domain (BET) proteins recognize lysine-acetylated histones, thereby regulating gene expression. Newly described small molecules that inhibit BET proteins BRD2, BRD3, and BRD4 reduce proliferation of
Noelia Luna-Peláez et al.
Cell death & disease, 10(8), 548-548 (2019-07-20)
Mutations in NIPBL are the major cause of Cornelia de Lange Syndrome (CdLS). NIPBL is the cohesin-loading factor and has recently been associated with the BET (bromodomains and extra-terminal (ET) domain) proteins BRD2 and BRD4. Related to this, a CdLS-like
Chang Soon Choi et al.
Neurochemical research, 40(11), 2211-2219 (2015-09-10)
The post translational modification of lysine acetylation is a key mechanism that regulates chromatin structure. Epigenetic readers, such as the BET domains, are responsible for reading histone lysine acetylation which is a hallmark of open chromatin structure, further providing a

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico