Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU053941

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Itgae

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCCTGGACCACTACAAGGAACCCTCTGCCATCTTCCAGCTGCCCTACGAGAAGGACTGCAAGAACAAAGTGTTCTGCATCGCTGAGATCCAGCTGACCACCAACATCTCCCAGCAGGAACTGGTGGTGGGCGTCACAAAGGAGGTGACCATGAACATCAGCCTGACTAACTCTGGAGAGGATTCCTACATGACAAACATGGCTCTCAATTATCCCAGAAACTTACAGTTTAAGAAGATACAAAAGCCAGTATCTCCAGATGTTCAGTGTGATGACCCCAAGCCAGTTGCTTCTGTCCTGGTCATGAACTGCAAGATTGGTCACCCCATACTCAAGAGATCATCTGTGAATGTCTCAGTAACTTGGCAGCTAGAGGAGAGTGTCTTTCCAAATAGGACAGCAGATATCACTGTGACCATCTCCAATTCCAATGAGAAGTCTTTGGCCAGAGAGACACGCAGCCTTCAAT

Ensembl | nº de acceso | ratón

ENSMUSG00000005947

Nº de acceso NCBI

NM_008399

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... ITGAE(16407) , Itgae(16407)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
AOR

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Jayashree Dolpady et al.
Journal of diabetes research, 2016, 7569431-7569431 (2016-01-19)
The gut microbiota modulates the autoimmune pathogenesis of type 1 diabetes (T1D) via mechanisms that remain largely unknown. The inflammasome components are innate immune sensors that are highly influenced by the gut environment and play pivotal roles in maintaining intestinal
Verena Moosbrugger-Martinz et al.
Journal of cellular and molecular medicine, 20(5), 930-938 (2016-03-05)
Atopic dermatitis (AD) is a widespread inflammatory skin disease with an early onset, characterized by pruritus, eczematous lesions and skin dryness. This chronic relapsing disease is believed to be primarily a result of a defective epidermal barrier function associated with
Duc Dung Le et al.
Respiratory research, 15, 73-73 (2014-07-02)
A neuroimmune crosstalk between dendritic cells (DCs) and airway nerves in the lung has recently been reported. However, the presence of DCs in airway sensory ganglia under normal and allergic conditions has not been explored so far. Therefore, this study

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico