Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU050951

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ehmt2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TGCCTATGTGGTCAGCTCAGTATCCGATGCTGGTATGACAAGGACGGGCGGCTGCTCCAGGAGTTTAACAAGATCGAGCCCCCCCTGATCTTTGAGTGTAACCAGGCATGCTCCTGCTGGAGAAGCTGCAAGAACCGCGTGGTGCAGAGCGGCATCAAGGTACGGCTGCAGCTCTACCGGACTGCCAAGATGGGCTGGGGGGTCCGAGCCTTGCAGACCATCCCCCAGGGCACGTTCATCTGCGAGTATGTAGGAGAGCTGATCTCTGATGCCGAGGCTGATGTGAGAGAGGATGATTCTTACCTCTTCGATTTAGATAACAAGGATGGCGAGGTTTACTGCATTGATGCCCGTTACTATGGCAACATCAGCCGATTCATTAACCACCTGTGTGACCCCAACATCATCCCTGTCCGGGTTTTCATGCTGCACCAAGA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Yize Li et al.
Advanced science (Weinheim, Baden-Wurttemberg, Germany), 7(13), 1902402-1902402 (2020-07-17)
Nerve injury-induced change in gene expression in primary sensory neurons of dorsal root ganglion (DRG) is critical for neuropathic pain genesis. N6-methyladenosine (m6A) modification of RNA represents an additional layer of gene regulation. Here, it is reported that peripheral nerve
Shuli Liu et al.
Oncotarget, 6(9), 6887-6901 (2015-03-10)
Head and neck squamous cell carcinoma (HNSCC) is a particularly aggressive cancer with poor prognosis, largely due to lymph node metastasis and local recurrence. Emerging evidence suggests that epithelial-to-mesenchymal transition (EMT) is important for cancer metastasis, and correlated with increased
Kee-Beom Kim et al.
Nucleic acids research, 43(7), 3509-3523 (2015-03-15)
Histone H3K9 methyltransferase (HMTase) G9a-mediated transcriptional repression is a major epigenetic silencing mechanism. UHRF1 (ubiquitin-like with PHD and ring finger domains 1) binds to hemimethylated DNA and plays an essential role in the maintenance of DNA methylation. Here, we provide

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico