Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU043721

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ephb4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAGCCATCAAGATGGGAAGATACGAGGAAAGTTTTGCAGCGGCTGGATTCGGCTCCTTTGAGGTGGTCAGTCAGATCTCTGCCGAGGACCTTCTCCGAATTGGAGTCACTCTGGCAGGACACCAGAAGAAAATCTTGGCCAGTGTGCAGCATATGAAGTCCCAAGCTAAGCCAGGAGCCCCTGGTGGGACAGGGGGACCAGCCCAGCAGTTCTGACCTCCAAGGACTCACCACCGTGGCAGATTCTTCTTTCCGGGAGGCAGAGTTGGGTGGGGACTCACAAGATGACCCCCTCCCCCTCGTCACAGCCTTCCCATTGGATTGCACTTTGAACAGAGGGGGTCGGAGACACAGGATTTGGGGAACCGTGCCATATGGGATCATACATGTGCCCTCCAGGCGGGGAACCCCAAACTCAGAGTGAGTCTTTCCCTCAAGACTGGGCAAAGAAACATCCCTACGTCTCTAACCTCCCATCTTCCCAGAGGGCTCTCTCCCCAAGCGCCTTCCACCTCAACGGGCATGTCCCTGCAGACCAAAGAGAAAGGGTGACCA

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xiuqing Li et al.
PloS one, 9(8), e105326-e105326 (2014-08-26)
Effective treatment of transitional cell carcinoma (TCC) of the bladder requires early diagnosis. Identifying novel molecular markers in TCC would guide the development of diagnostic and therapeutic targets. Ephrins mediate signals via tyrosine kinase activity that modulates diverse physiologic and
Thao M Nguyen et al.
Stem cells (Dayton, Ohio), 33(9), 2838-2849 (2015-06-03)
The tyrosine kinase receptor, EphB4, mediates cross-talk between stromal and hematopoietic populations during bone remodeling, fracture repair and arthritis, through its interactions with the ligand, ephrin-B2. This study demonstrated that transgenic EphB4 mice (EphB4 Tg), over-expressing EphB4 under the control
Inga Mertens-Walker et al.
Experimental cell research, 333(1), 105-115 (2015-03-01)
The EphB4 receptor tyrosine kinase is over-expressed in a variety of different epithelial cancers including prostate where it has been shown to be involved in survival, migration and angiogenesis. We report here that EphB4 also resides in the nucleus of

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico