Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU033531

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Gabpa

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TGCAGTGTTCTTTGGATGCTCATGAAATTTGCCTGCAAGATATTCAGCTGGATCCAGACCGAAGCTTGTTTGATCAAGGAGTGAAAACAGATGGGACTGTACAGCTTAGTGTACAGGTAATTTCTTACCAAGGAATGGAGCCAAAGTTGAACATTCTTGAAATTGTTAAGACTGCGGAAACGGTCGAGGTGGTCATCGATCCAGATGCCCACCACGCGGAAGCAGAAGCGCATCTCGTTGAAGAAGCTCAAGTGATAACTCTTGACGGCACCAAGCACATTACGACCATTTCAGACGAGACCTCGGAGCAGGTGACGAGATGGGCTGCTGCACTGGAAGGCTACAGAAAAGAGCAGGAGCGCCTTGGCATCCCCTATGATCCTATACACTGGTCCACGGACCAAGTCCTGCATTGGGTGGTTTGGGTAATGAAGGAGTTCAGCATGACTGATATAGACCTCACCACACTCAACATTTCGG

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bo-hyun Choi et al.
PloS one, 9(9), e107158-e107158 (2014-09-17)
Photodynamic therapy (PDT) has emerged as an effective treatment for various solid tumors. The transcription factor NRF2 is known to protect against oxidative and electrophilic stress; however, its constitutive activity in cancer confers resistance to anti-cancer drugs. In the present
Laura Gambari et al.
Pharmacological research, 87, 99-112 (2014-07-08)
Hydrogen sulfide (H2S), which recently emerged as a potent regulator of tissues and organs, is broadly produced in mammalian cells but whether it can regulate bone cell function is still elusive. The main objective of this study was to establish
Hitoshi Murata et al.
PloS one, 10(11), e0142438-e0142438 (2015-11-12)
Mutations of the PTEN-induced putative kinase 1 (PINK1) gene are a cause of autosomal recessive forms of Parkinson's disease. Recent studies have revealed that PINK1 is an essential factor for controlling mitochondrial quality, and that it protects cells from oxidative

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico