Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos

EMU030751

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cd9

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

CGGTCAAAGGAGGTAGCAAGTGCATCAAATACCTGCTCTTCGGATTTAACTTCATCTTCTGGCTCGCTGGCATTGCAGTGCTTGCTATTGGACTATGGCTCCGATTCGACTCTCAGACCAAGAGCATCTTCGAGCAAGAGAATAACCATTCCAGTTTCTACACAGGAGTGTACATTCTGATTGGAGCCGGGGCCCTCATGATGCTGGTTGGTTTCCTGGGCTGCTGTGGAGCTGTACAAGAGTCCCAGTGCATGCTGGGATTGTTCTTCGGGTTCCTCTTGGTGATATTCGCCATTGAGATAGCCGCCGCCGTCTGGGGCTATACCCACAAGGATGAGGTGATTAAAGAACTCCAGGAGTTTTACAAGGACACCTACCAAAAGTTACGGAGCAAGGATGAACCCCAGCGGGAAACACTCAAAGCCATCCATATGGCGTTGGACTGCTGTGGCATAGCTGGTCCTTTGGAGC

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

Categorías relacionadas

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Germana Rappa et al.
Oncotarget, 6(10), 7970-7991 (2015-03-13)
Interaction of breast cancer cells (BCCs) with stromal components is critical for tumor growth and metastasis. Here, we assessed the role of CD9 in adhesion, migration and invasiveness of BCCs. We used co-cultures of BCCs and bone marrow-derived multipotent mesenchymal
Gong-Ping Wang et al.
Molecular medicine reports, 12(1), 1381-1386 (2015-03-12)
The tetraspanin CD9 has previously been shown to be involved in various cellular activities, including proliferation and migration. In addition, CD9 has been shown to be associated with epidermal growth factor receptor (EGFR). A common characteristic of glioblastoma multiforme histology
Michael J Herr et al.
PloS one, 9(9), e106999-e106999 (2014-09-04)
The most prevalent cardiovascular diseases arise from alterations in vascular smooth muscle cell (VSMC) morphology and function. Tetraspanin CD9 has been previously implicated in regulating vascular pathologies; however, insight into how CD9 may regulate adverse VSMC phenotypes has not been
Jian Huan et al.
International journal of clinical and experimental pathology, 8(3), 3054-3061 (2015-06-06)
Esophageal squamous cell carcinoma (ESCC) is one of the leading causes of cancer deaths worldwide. CD9 has been reported to play a critical role in cell motility, growth and metastasis of multiple cancers. The present study investigated the clinicopathological features

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico