Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU030031

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Ddit3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GAATAACAGCCGGAACCTGAGGAGAGAGTGTTCCAGAAGGAAGTGCATCTTCATACACCACCACACCTGAAAGCAGAACCTGGTCCACGTGCAGTCATGGCAGCTGAGTCCCTGCCTTTCACCTTGGAGACGGTGTCCAGCTGGGAGCTGGAAGCCTGGTATGAGGATCTGCAGGAGGTCCTGTCCTCAGATGAAAATGGGGGCACCTATATCTCATCCCCAGGAAACGAAGAGGAAGAATCAAAAACCTTCACTACTCTTGACCCTGCGTCCCTAGCTTGGCTGACAGAGGAGCCAGGGCCAACAGAGGTCACACGCACATCCCAAAGCCCTCGCTCTCCAGATTCCAGTCAGAGTTCTATGGCCCAGGAGGAAGAGGAGGAAGAGCAAGGAAGAACTAGGAAACGGAAACAGAGTGGTCAGTGCCCAGCCCGGCCTGGGAAGCAACGCATGAAGGAGAAGGAGCAG

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Clase de riesgo para el agua (WGK)

WGK 1

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

E Aflaki et al.
Cell death & disease, 3, e280-e280 (2012-03-16)
Triacylglycerol (TG) accumulation caused by adipose triglyceride lipase (ATGL) deficiency or very low-density lipoprotein (VLDL) loading of wild-type (Wt) macrophages results in mitochondrial-mediated apoptosis. This phenotype is correlated to depletion of Ca(2+) from the endoplasmic reticulum (ER), an event known
Xin-Yu Zhang et al.
The international journal of biochemistry & cell biology, 68, 158-165 (2015-09-28)
Arsenic trioxide has been proven to trigger apoptosis in human hepatocellular carcinoma cells. Endoplasmic reticulum stress has been known to be involved in apoptosis through the induction of CCAAT/enhancer-binding protein homologous protein. However, it is unknown whether endoplasmic reticulum stress
Wen-Pin Cheng et al.
PloS one, 10(4), e0123235-e0123235 (2015-04-22)
The expression of TRB3 (tribbles 3), an apoptosis regulated gene, increases during endoplasmic reticulum (ER) stress. How mechanical stress affects the regulation of TRB3 in cardiomyocytes during apoptosis is not fully understood. An in vivo model of aorta-caval shunt in
Lu Fan et al.
Toxicology and applied pharmacology, 278(1), 45-52 (2014-04-29)
Erlotinib, a popular drug for treating non-small cell lung cancer (NSCLC), causes diarrhea in approximately 55% of patients receiving this drug. In the present study, we found that erlotinib induced barrier dysfunction in rat small intestine epithelial cells (IEC-6) by
Xiuhua Zhang et al.
BMC cancer, 15, 866-866 (2015-11-08)
Prostate cancer is the most commonly diagnosed malignancy among men. The Discovery of new agents for the treatment of prostate cancer is urgently needed. Compound WZ35, a novel analog of the natural product curcumin, exhibited good anti-prostate cancer activity, with

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico