Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU029181

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tcp1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
$220.00
50 μG
$391.00

$220.00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).


Seleccione un Tamaño

Cambiar Vistas
20 μG
$220.00
50 μG
$391.00

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

$220.00


Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TTAACGCAGACGAACTTGGAAGAGACTGTCTGACCAATACTGCTAAGACATCCATGTCTTCCAAAATTATTGGAATAAATGGTGATTACTTTGCTAATATGGTAGTAGATGCTGTGCTTGCTGTTAAATACACAGATGCCAGAGGCCAGCCTCGCTATCCAATCAATTCTGTTAATATTCTGAAAGCCCATGGGAGAAGTCAGATAGAAAGCATGCTGATCAATGGCTATGCGCTCAATTGTGTGGTTGGATCTCAGGGCATGCCCAAGAGAATAGTTAATGCAAAAATTGCTTGTCTTGACTTCAGCCTGCAGAAAACAAAAATGAAGCTTGGTGTACAGGTGGTTATTACAGACCCTGAGAAATTGGACCAAATTAGACAGAGAGAATCGGATATCACCAAGGAGAGAATTCAGAAGATCCTGGCAACTGGTGCCAATGTTATTCTAACCACTGGTGGCATTG

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Shuai Ye et al.
International journal of oncology, 44(6), 2153-2159 (2014-04-11)
p63 is a member of the p53 protein family and plays a crucial role in epithelial development. p63 is expressed in many types of tumors including esophageal cancer; however, its function in cancer is controversial and its role in esophageal
Renata L Linardi et al.
Veterinary dermatology, 26(4), 213-e47-213-e47 (2015-05-13)
The limited characterization of equine skin, eye and hoof epithelial stem cell (ESC) and differentiation markers impedes the investigation of the physiology and pathophysiology of these tissues. To characterize ESC and differentiation marker expression in epithelial tissues of the equine
Hulda R Jonsdottir et al.
Laboratory investigation; a journal of technical methods and pathology, 95(12), 1418-1428 (2015-09-22)
Idiopathic pulmonary fibrosis (IPF) is a progressive interstitial lung disease with high morbidity and mortality. The cellular source of the fibrotic process is currently under debate with one suggested mechanism being epithelial-to-mesenchymal transition (EMT) in the alveolar region. In this

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico