Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos

EMU028861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cdkn1c

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TTTAGAGGCTAACGGCCAGAGAGAACTTGCTGGGCATCTGGGCAGCGGACGATGGAAGAACTCTGGGCTTCGGCTGGGACCTTTCGTTCATGTAGCAGGAACCGGAGATGGTTGCGTAGAGCAGCCCACGGTTTTGTGGAAATCTGAAAACTGTGCAATGTATTGAGAACACTCTGTACCATGTGCAAGGAGTACGCTGGTCCCAAGGTGTAAAGCTTTAAATCATTTATGTAAAATGTTTAATCTCTACTCGCTCTCAGTGCAAAACAAAAAGAGAAACTAGAAAATGTAGAACGAAGGAAAAAGATGAGAAAAAGGAAAAAGCATGTATATTTGTACAAAAAGTTAAAAAATTATGCTAATTTAATATTTGTATTTATCCATGCGTGGATCCCTCTGCCACGCAACTGCTGGGTTATTGATTATTACCAAAGGCACTAGAAATCACCAGCTTCAGATTACCCA

Ensembl | mouse accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

H M Coley et al.
British journal of cancer, 106(3), 482-489 (2012-01-12)
Carboplatin remains a first-line agent in the management of epithelial ovarian cancer (EOC). Unfortunately, platinum-resistant disease ultimately occurs in most patients. Using a novel EOC cell line with acquired resistance to carboplatin: PEO1CarbR, genome-wide micro-array profiling identified the cyclin-dependent kinase
Elizabeth M Algar et al.
PloS one, 4(2), e4482-e4482 (2009-02-18)
SMARCB1 is deleted in rhabdoid tumor, an aggressive paediatric malignancy affecting the kidney and CNS. We hypothesized that the oncogenic pathway in rhabdoid tumors involved epigenetic silencing of key cell cycle regulators as a consequence of altered chromatin-remodelling, attributable to
Hui Guo et al.
BMC gastroenterology, 15, 104-104 (2015-08-15)
Our previous research suggested that p57 downregulation could accelerate the growth and invasion of hepatocellular carcinoma in vitro and in vivo. To evaluate the role of cytoplasmic p57 and its regulatory mechanism during hepatocellular carcinoma invasion. We examined the subcellular
Jihong Zhang et al.
Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie, 71, 7-14 (2015-05-12)
MicroRNAs (miRNA) have oncogenic or tumor-suppressive roles in the development and growth of human glioma. Glioma development is also associated with alteration in the activities and expression of cell cycle regulators, and miRNAs are emerging as important regulators of cell

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico