Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU021521

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tiam1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CAGATGGCAAGAGGGAGAAGGAAGTGGTCTTACCCAGTGTCCACCAGCACAACCCCGACTGTGACATTTGGGTCCATGAATATTTCACTCCATCCTGGTTCTGTCTACCCAACAACCAGCCAGCCTTGACGGTTGTCCGGCCAGGGGACACTGCGAGGGACACCTTGGAGCTCATTTGCAAGACACATCAACTGGATCATTCCGCCCATTACCTGCGCCTGAAATTCCTAATGGAGAACAGAGTGCAGTTCTACATCCCGCAGCCCGAGGAGGACATTTACGAGCTGCTTTACAAAGAAATTGAAATCTGTCCAAAAGTCACCCAGAATATCCACATTGAGAAGTCAGACGCGGCCGCTGATAATTACGGGTTTTTGCTTTCTTCTGTGGATGAAGATGGCATTCGAAGGCTCTACGTGAACAGTGTCAAGGAAACCGGGTTAG

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mina Ding et al.
OncoTargets and therapy, 11, 4367-4375 (2018-08-14)
T-cell lymphoma invasion and metastasis inducing factor 1 (Tiam1) is known to be involved in tumor progression. However, its molecular roles and mechanism in pancreatic ductal adenocarcinoma (PDAC) remain unclear. The purpose of this study is to determine Tiam1 expression
Minjuan Wu et al.
Clinical science (London, England : 1979), 129(7), 575-588 (2015-05-23)
The homing ability and secretory function of mesenchymal stem cells (MSCs) are key factors that influence cell involvement in wound repair. These factors are controlled by multilayer regulatory circuitry, including adhesion molecules, core transcription factors (TFs) and certain other regulators.
G Zhu et al.
Oncogene, 34(49), 5971-5982 (2015-03-10)
Epidermal growth factor receptor (EGFR) signaling regulates cell growth and survival, and its overactivation drives cancer development. One important branch of EGFR signaling is through activation of GTPase Rac1, which further promotes cell proliferation, survival and cancer metastasis. Here, we
Helen J Whalley et al.
Nature communications, 6, 7437-7437 (2015-06-17)
Centrosome separation is critical for bipolar spindle formation and the accurate segregation of chromosomes during mammalian cell mitosis. Kinesin-5 (Eg5) is a microtubule motor essential for centrosome separation, and Tiam1 and its substrate Rac antagonize Eg5-dependent centrosome separation in early

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico