Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU021201

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Wnt2

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CATGGACAGCTGCGAAGTTATGTGTTGTGGGAGAGGCTATGACACATCCCACGTCACCCGGATGACCAAGTGTGAGTGTAAATTCCACTGGTGCTGTGCCGTGCGCTGTCAGGACTGCCTGGAGGCCCTGGACGTGCACACATGCAAGGCCCCCAAGAGTGCCGACTGGGCGACGCCTACATGACCTCAGCAGAGGTCATATTCGCCTTTTCTTCCCTCAAGGACTCCAATTACATCTTCAAGGACACTGGACCTCTGGGTTGTTTTCAGGGGCTCTTTCTTAAGGCATGAAGCCTTCATCTCAAGAGAAACCCCCTTTCCCCTCTCTGGGGGCCCCAGGACTGGGAACCACCTGCTGCACATAAGTACACCCTATTCTGTCTATCTTGGGCATTCTGATGTCACCTCTCTTCCTGCTGATTTCTTTTTGGAAATGGCATGACA

Ensembl | nº de acceso | ratón

ENSMUSG00000010797

Nº de acceso NCBI

NM_023653

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... WNT2(22413) , Wnt2(22413)

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Nan Lian et al.
Cell cycle (Georgetown, Tex.), 17(24), 2745-2755 (2018-12-28)
The aim of this study was to investigate the mechanism of miR-221 in depression. The molecules expressions were measured by qRT-PCR and western blot. The sucrose preference test (SPT), forced swimming test (FST) and tail suspension test (TST) were used
W-J Zhou et al.
Translational psychiatry, 6(9), e892-e892 (2016-09-14)
Wnts-related signaling pathways have been reported to play roles in the pathogenesis of stress-induced depression-like behaviors. However, there is relatively few direct evidence to indicate the effect of Wnt ligands on this process. Here, we investigated the role of Wnts

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico