Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU020861

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cd276

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GACCAGGATGGAGATGGAGAAGGATCCAAGACAGCTCTACGGCCTCTGAAACCCTCTGAAAACAAAGAAGATGACGGACAAGAAATTGCTTGATTGGGAGCTGCTGCCCTTCCCAGGTGGGGGGCCCACCCTCTGGCAGTGTTGAGCTTCAATGCGAGCCCTTCCCCCCAACGAATGGGTTTGTCCCACAGATCTACCCGTTCGTCAAAGGACGTGGTCCATAGACCACCCACAGCCTTACTTTTCCAATGGACTTAATTCCCATCATCCTGCAGCCTCATTTCTCCAGTGACACGATACACGAACCATCCTGCGGCCTTATTTCCCACGGACACGACACAAAGATGTCCCTCCTCGGTGTTCCTCCAGAGTCGTCTGGTGGCCTTGTGATACGGCGTGAACCTTCTTCCTTCTGCCTTACGTCTAATGGACACACACGCACC

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Feifei Wang et al.
Cancer investigation, 32(6), 262-271 (2014-05-03)
B7-H3 has been detected in different cancers and correlated to tumor progression and outcome in cancer patients. In this study, we investigated the expression of B7-H3 in tissues and cells of primary hepatocellular carcinoma (PHC) patients. The research showed that
Wei Zhang et al.
OncoTargets and therapy, 8, 1721-1733 (2015-07-24)
The role of B7-H3 in acute monocytic leukemia U937 cells has not been thoroughly investigated. B7-H3 knockdown in the U937 cell line was performed using small hairpin (sh)RNA lentivirus transduction. The effects on cell proliferation, cycle, migration, and invasion were
Fu-Biao Kang et al.
Cancer cell international, 15, 45-45 (2015-04-25)
B7-homologue 3 (B7-H3), a recently identified immunoregulatory protein, has been shown to be overexpressed in human hepatocellular carcinoma (HCC). However, whether the dynamic expression pattern of B7-H3 contributes to early invasion of HCC is largely unknown. In addition, the biological

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico