Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU018591

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Tcf4

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

TCATATCCCACAGTCCAGCAGCTACTGTAGCCTGCATCCACACGAACGTTTGAGCTATCCATCCCACTCCTCGGCAGACATCAACTCCAGTCTTCCTCCGATGTCCACGTTCCATCGTAGTGGCACAAACCATTACAGCACCTCTTCCTGCACACCCCCTGCCAACGGAACAGACAGTATAATGGCAAACAGAGGAACTGGGGCAGCAGGCAGCTCGCAGACTGGAGACGCTCTGGGGAAAGCCCTAGCTTCGATCTATTCTCCTGACCACACGAACAACAGCTTTTCCTCCAATCCTTCAACTCCTGTGGGCTCCCCTCCTTCACTCTCAGCAGGCACAGCTGTTTGGTCTAGAAATGGAGGACAGGCCTCGTCATCTCCCAATTATGAAGGACCCTTGCACTCACTGCAAAGCCGAATCGAAGACCGTTTGGAA

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

J Wang et al.
British journal of cancer, 111(1), 112-124 (2014-05-31)
Invasion and metastasis remain a critical issue in cervical cancer. However, the underlying mechanism of it in cervical cancer remains unclear. The newly discovered protein, TBLR1, plays a crucial role in regulating various key cellular functions. In this study, western
Menglan Cheng et al.
Scientific reports, 5, 10752-10752 (2015-07-18)
Dendritic cells (DCs) are sentinels of the immune system and comprise two distinct subsets: conventional DCs (cDCs) and plasmacytoid DCs (pDCs). Human pDCs are distinguished from mouse pDCs phenotypically and functionally. Basic helix-loop-helix protein E2-2 is defined as an essential

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico