Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU013051

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Cav1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CATCAGCACGCAGAAAGAGATATGAGGGACATTTCAAGGATGAAAGGTTTTTTCCCCCCTTACTATTTCCTTGGTGCCAATTCCAAGTTGCTCTCGCAGCAGCAAATTTATGAATGGTTTGTCTTGATCAAGAACAAAGAATTCATTCCCACCATTCTCATATATACTACTTGTCTCTTCTAAGCTACTGCATCTATGTTTGACAGTCTGGAATGTTTAAACCCATTCCTGCTCTCTCTTTTATATGTGAATCATTGTTTCATTGGCTAAAATATAAACATATTGTTGAAAGATGATTTGAGAAAAATAGGAAGGACTGGGAGGCAGGGAAGAGTACCAACAACCTCAACTGCCTACTCAAAGGTGATGATGTCATACAAAGGGAAGAGATTCAGGTTACGGCCATTTGTTTAGGGGCATGAAGG

Ensembl | nº de acceso | ratón

ENSMUSG00000007655

Nº de acceso NCBI

NP_031642

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

mouse ... CAV1(12389) , Cav1(12389)

Categorías relacionadas

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
VQU
DOU
QJU
VFU
UXT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Carmen Juks et al.
Biochimica et biophysica acta, 1848(12), 3205-3216 (2015-09-27)
Cell penetrating peptides are efficient tools to deliver various bioactive cargos into cells, but their exact functioning mechanism is still debated. Recently, we showed that a delivery peptide PepFect14 condenses oligonucleotides (ON) into negatively charged nanocomplexes that are taken up
Jing Zeng et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 37(4), 1289-1300 (2015-10-03)
Pulmonary microvascular endothelial cell (PMVEC) proliferation and angiogenesis contribute to the development of hepatopulmonary syndrome (HPS). MicroRNA-199a-5p (miR-199a-5p) has emerged as a potent regulator of angiogenesis, and its expression levels significantly decrease in the serum of patients with hepatopathy. However
Fanrui Meng et al.
PloS one, 10(5), e0126056-e0126056 (2015-05-06)
Expression of Caveolin-1 (Cav1), a key component of cell surface caveolae, is elevated in prostate cancer (PCa) and associated with PCa metastasis and a poor prognosis for PCa patients. Polymerase I and Transcript Release Factor (PTRF)/cavin-1 is a cytoplasmic protein
Emily J Guggenheim et al.
Nanotoxicology, 14(4), 504-532 (2020-02-11)
Engineered Nanomaterials (NMs), such as Superparamagnetic Iron Oxide Nanoparticles (SPIONs), offer significant benefits in a wide range of applications, including cancer diagnostic and therapeutic strategies. However, the use of NMs in biomedicine raises safety concerns due to lack of knowledge
Q Chen et al.
Cellular and molecular biology (Noisy-le-Grand, France), 61(2), 33-38 (2015-05-31)
Bladder cancer occurs in the majority of cases in males, which represents the fourth highest incident cancer in men and tenth in women. It is associated with a high rate of recurrence, and prognosis is poor once the cancer metastasizes
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico