Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU008231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stim1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Seleccione un Tamaño

20 μG
$220.00
50 μG
$391.00

$220.00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).
Todas las fotos(1)

Seleccione un Tamaño

Cambiar Vistas
20 μG
$220.00
50 μG
$391.00

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

$220.00

Normalmente se envían en 3 semanas (de 4 a 6 semanas para pedidos personalizados).

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

AAGCTTATCAGCGTGGAGGACCTGTGGAAGGCGTGGAAATCATCAGAAGTGTACAACTGGACTGTGGATGAGGTGATACAGTGGCTCATTACGTATGTGGAGCTGCCACAGTATGAGGAGACCTTCCGGAAGTTGCAGCTTACTGGCCACGCCATGCCAAGGCTAGCAGTAACCAACACCACCATGACAGGGACTGTACTGAAGATGACAGATCGGAGCCACAGGCAGAAGCTGCAGCTGAAGGCCCTGGACACAGTGCTGTTTGGGCCTCCTCTCTTGACTCGGCATAATCACCTGAAGGACTTCATGCTGGTGGTGTCTATCGTTATTGGTGTGGGTGGCTGCTGGTTTGCCTATATCCAGAACCGTTACTCTAAGGAGCACATGAAGAAAATGATGAAGGATCTGGAAGGG

Ensembl | mouse accession no.

ENSMUSG00000030987

NCBI accession no.

NM_009287

shipped in

ambient

storage temp.

−20°C

Gene Information

mouse ... STIM1(20866) , Stim1(20866)

General description

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

Lo sentimos, en este momento no disponemos de COAs para este producto en línea.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ziying Han et al.
PLoS pathogens, 11(10), e1005220-e1005220 (2015-10-30)
Hemorrhagic fever viruses, including the filoviruses (Ebola and Marburg) and arenaviruses (Lassa and Junín viruses), are serious human pathogens for which there are currently no FDA approved therapeutics or vaccines. Importantly, transmission of these viruses, and specifically late steps of
Raz Palty et al.
Cell research, 25(8), 963-980 (2015-07-04)
Calcium flux through store-operated calcium entry is a major regulator of intracellular calcium homeostasis and various calcium signaling pathways. Two key components of the store-operated calcium release-activated calcium channel are the Ca(2+)-sensing protein stromal interaction molecule 1 (STIM1) and the
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A
J-Y Wang et al.
Oncogene, 34(33), 4358-4367 (2014-11-11)
Tumor metastasis is the major cause of death among cancer patients, with >90% of cancer-related death attributable to the spreading of metastatic cells to secondary organs. Store-operated Ca(2+) entry (SOCE) is the predominant Ca(2+) entry mechanism in most cancer cells

Questions

Reviews

No rating value

Active Filters

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico