Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EMU008231

Sigma-Aldrich

MISSION® esiRNA

targeting mouse Stim1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AAGCTTATCAGCGTGGAGGACCTGTGGAAGGCGTGGAAATCATCAGAAGTGTACAACTGGACTGTGGATGAGGTGATACAGTGGCTCATTACGTATGTGGAGCTGCCACAGTATGAGGAGACCTTCCGGAAGTTGCAGCTTACTGGCCACGCCATGCCAAGGCTAGCAGTAACCAACACCACCATGACAGGGACTGTACTGAAGATGACAGATCGGAGCCACAGGCAGAAGCTGCAGCTGAAGGCCCTGGACACAGTGCTGTTTGGGCCTCCTCTCTTGACTCGGCATAATCACCTGAAGGACTTCATGCTGGTGGTGTCTATCGTTATTGGTGTGGGTGGCTGCTGGTTTGCCTATATCCAGAACCGTTACTCTAAGGAGCACATGAAGAAAATGATGAAGGATCTGGAAGGG

Ensembl | nº de acceso | ratón

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION® esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Ziying Han et al.
PLoS pathogens, 11(10), e1005220-e1005220 (2015-10-30)
Hemorrhagic fever viruses, including the filoviruses (Ebola and Marburg) and arenaviruses (Lassa and Junín viruses), are serious human pathogens for which there are currently no FDA approved therapeutics or vaccines. Importantly, transmission of these viruses, and specifically late steps of
Raz Palty et al.
Cell research, 25(8), 963-980 (2015-07-04)
Calcium flux through store-operated calcium entry is a major regulator of intracellular calcium homeostasis and various calcium signaling pathways. Two key components of the store-operated calcium release-activated calcium channel are the Ca(2+)-sensing protein stromal interaction molecule 1 (STIM1) and the
Jingsheng Xia et al.
The Journal of physiology, 592(16), 3443-3461 (2014-05-27)
Store-operated calcium channels (SOCs) are calcium-selective cation channels that mediate calcium entry in many different cell types. Store-operated calcium entry (SOCE) is involved in various cellular functions. Increasing evidence suggests that impairment of SOCE is responsible for numerous disorders. A
J-Y Wang et al.
Oncogene, 34(33), 4358-4367 (2014-11-11)
Tumor metastasis is the major cause of death among cancer patients, with >90% of cancer-related death attributable to the spreading of metastatic cells to secondary organs. Store-operated Ca(2+) entry (SOCE) is the predominant Ca(2+) entry mechanism in most cancer cells

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico