Todas las fotos(1)

Documentos clave

Certificado de origen (COO)/COA

EHU156861

MISSION^® esiRNA

Name: MISSION<SUP>®</SUP> esiRNA
Brand: SIGMA

targeting human IKZF1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización

Todas las fotos(1)

About This Item

Código UNSPSC:

41105324

NACRES:

NA.51

descripción

Nivel de calidad

100

Línea del producto

MISSION^®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GGGGAGCAGATGAAGGTGTACAAGTGCGAACACTGCCGGGTGCTCTTCCTGGATCACGTCATGTACACCATCCACATGGGCTGCCACGGCTTCCGTGATCCTTTTGAGTGCAACATGTGCGGCTACCACAGCCAGGACCGGTACGAGTTCTCGTCGCACATAACGCGAGGGGAGCACCGCTTCCACATGAGCTAAAGCCCTCCCGCGCCCCCACCCCAGACCCCGAGCCACCCCAGGAAAAGCACAAGGACTGCCGCCTTCTCGCTCCCGCCAGCAGCATAGACTGGACTGGACCAGACAATGTTGTGTTTGGATTTGTAACTGTTTTTTGTTTTTTGTTTGAGTTGGTTGATTGGGGTTTGATTTGCTTTTGAAAAGATTTTTATTTTTAGAGGCAGGGCTGCATTGGGAGCATCCAGAACTGCTACCTTCCTAGATGTTTCCCCAGACCGCTGGCTGAGATTCCCTCACCTGTCGCTTCCTAG

Ensembl | nº de acceso humano

ENSG00000185811

Nº de acceso NCBI

NM_006060

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... IKZF1(10320) , IKZF1(10320)

Categorías relacionadas

MISSION® esiRNA

Oligos, qPCR Probes & Peptides

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Tumor Arrests DN2 to DN3 Pro T Cell Transition and Promotes Its Conversion to Thymic Dendritic Cells by Reciprocally Regulating Notch1 and Ikaros Signaling.

Ipsita Guha et al.

Frontiers in immunology, 11, 898-898 (2020-06-26)

Tumor progression in the host leads to severe impairment of intrathymic T-cell differentiation/maturation, leading to the paralysis of cellular anti-tumor immunity. Such suppression manifests the erosion of CD4+CD8+ double-positive (DP) immature thymocytes and a gradual increase in CD4-CD8- double negative

IKAROS is required for the measured response of NOTCH target genes upon external NOTCH signaling.

Maud Lemarié et al.

PLoS genetics, 17(3), e1009478-e1009478 (2021-03-27)

The tumor suppressor IKAROS binds and represses multiple NOTCH target genes. For their induction upon NOTCH signaling, IKAROS is removed and replaced by NOTCH Intracellular Domain (NICD)-associated proteins. However, IKAROS remains associated to other NOTCH activated genes upon signaling and

Ikaros deletions in BCR-ABL-negative childhood acute lymphoblastic leukemia are associated with a distinct gene expression signature but do not result in intrinsic chemoresistance.

Nicholas A Vitanza et al.

Pediatric blood & cancer, 61(10), 1779-1785 (2014-07-01)

Ikaros, the product of IKZF1, is a regulator of lymphoid development and polymorphisms in the gene have been associated with the acute lymphoblastic leukemia (ALL). Additionally, IKZF1 deletions and mutations identify high-risk biological subsets of childhood ALL [Georgopoulos et al.

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico