Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU155731

Sigma-Aldrich

MISSION® esiRNA

targeting human CCR7

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

100

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

TCCAGGTATGCCTGTGTCAAGATGAGGTCACGGACGATTACATCGGAGACAACACCACAGTGGACTACACTTTGTTCGAGTCTTTGTGCTCCAAGAAGGACGTGCGGAACTTTAAAGCCTGGTTCCTCCCTATCATGTACTCCATCATTTGTTTCGTGGGCCTACTGGGCAATGGGCTGGTCGTGTTGACCTATATCTATTTCAAGAGGCTCAAGACCATGACCGATACCTACCTGCTCAACCTGGCGGTGGCAGACATCCTCTTCCTCCTGACCCTTCCCTTCTGGGCCTACAGCGCGGCCAAGTCCTGGGTCTTCGGTGTCCACTTTTGCAAGCTCATCTTTGCCATCTACAAGATGAGCTTCTTCAGTGGCATGCTCCTACTTCTTTGCATCAGCATTGACC

Ensembl | human accession no.

ENSG00000126353

NCBI accession no.

NM_001838

shipped in

ambient

storage temp.

−20°C

Gene Information

human ... CCR7(1236) , CCR7(1236)

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

¿No encuentra el producto adecuado?  

Pruebe nuestro Herramienta de selección de productos.

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable

Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Bing Xu et al.
Cancer medicine, 6(5), 1062-1071 (2017-04-06)
Chemokine and the chemokine receptor have a key role in the tumor progress. Here, we supposed that CCR7 might induce the invasion, migration, and epithelial-mesenchymal transition (EMT) process of breast cancer. In this research, human breast cancer MCF-7 and MDA-MB-231cells
Pelin Kaya et al.
Nutrients, 11(2) (2019-02-20)
Curcumae radix is the dry root of Curcuma longa L. (turmeric) that can be used either as a spice or traditional medicine. The aim of this study was to investigate the survival benefits and the anti-metastatic activity of curcumae radix
Lin-Hui Yuan et al.
International journal of ophthalmology, 10(6), 862-869 (2017-07-22)
To investigate the role of CCR7/p-ERK1/2/VEGF signaling in the mouse model of oxygen-induced retinopathy (OIR). Neonatal C57BL/6J mice were evenly randomized into four groups: normoxia, OIR, OIR control (treated with scramble siRNA), and OIR treated (treated with CCR7 siRNA). Normoxia
Fei Li et al.
Medical oncology (Northwood, London, England), 31(9), 180-180 (2014-08-22)
Secondary lymphoid tissue chemokine (SLC/CCL21) and its receptor CCR7 have been implicated in lymph node metastasis, whereas the mechanism of which remains unclear. Epithelial-mesenchymal transition (EMT) plays an important role in invasion and migration of cancer cells. We presumed that
Kaori Kubo et al.
Biochemical and biophysical research communications, 463(4), 825-831 (2015-06-24)
Chronic myeloid leukemia is a clonal disease characterized by the presence of the Philadelphia chromosome and its oncogenic product, BCR-ABL, which activates multiple pathways involved in cell survival, growth promotion, and disease progression. We previously reported that in murine hematopoietic
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico