Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU153321

Sigma-Aldrich

MISSION® esiRNA

targeting human CCND1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AACTACCTGGACCGCTTCCTGTCGCTGGAGCCCGTGAAAAAGAGCCGCCTGCAGCTGCTGGGGGCCACTTGCATGTTCGTGGCCTCTAAGATGAAGGAGACCATCCCCCTGACGGCCGAGAAGCTGTGCATCTACACCGACAACTCCATCCGGCCCGAGGAGCTGCTGCAAATGGAGCTGCTCCTGGTGAACAAGCTCAAGTGGAACCTGGCCGCAATGACCCCGCACGATTTCATTGAACACTTCCTCTCCAAAATGCCAGAGGCGGAGGAGAACAAACAGATCATCCGCAAACACGCGCAGACCTTCGTTGCCCTCTGTGCCACAGATGTGAAGTTCATTTCCAATCCGCCCTCCATGGTGGCAGCGGGGAGCGTGGTGGCCGCAGTGCAAGGCCTGAACCTGAGGAGCCCCAACAACTTCCTGTCCTACTACCGCCTCA

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mingming Wang et al.
Journal of cellular physiology, 235(2), 1588-1600 (2019-07-17)
Prostate cancer (PCa) is one of the major health problems of the aging male. The roles of dysregulated microRNAs in PCa remain unclear. In this study, we mined the public published data and found that miR-487a-3p was significantly downregulated in
Chuanyong Wu et al.
Journal of Cancer, 11(7), 1959-1967 (2020-03-21)
Accumulating evidences showed that aberrantly expressed long noncoding RNAs (lncRNAs) have critical roles in many cancers. However, the expression and roles of a poorly studied lncRNA PCNA-AS1 in non-small-cell lung cancer (NSCLC) remain unknown. In this study, we investigated the
Xiaohong Jiang et al.
Gene therapy, 27(12), 557-566 (2020-06-07)
LncRNAs are reported to participate in the progression of various diseases including diabetic nephropathy. Currently, we reported that SNHG16 was obviously upregulated in db/db mice and high glucose-treated mice mesangial cells. Then, functional experiments showed that SNHG16 silencing significantly inhibited
Hao Ding et al.
Journal of pharmacological sciences, 143(3), 219-225 (2020-05-19)
Chemoresistance is one of the major barriers in chemotherapy-based hepatocellular carcinoma (HCC) intervention. 5-Fluorouracil (5-Fu) is a widely used as an anticancer drug. Liver cancer stem cells (LCSCs) are considered the origin of tumor recurrence and resistance. CCND1 (Cyclin D1)
Dexin Yin et al.
Cellular physiology and biochemistry : international journal of experimental cellular physiology, biochemistry, and pharmacology, 49(4), 1499-1511 (2018-09-12)
Recent studies have suggested that several lncRNAs contribute to the angiogenic function of endothelial cells. Herein, we set out to reveal whether lncRNA UCA1 has functions in endothelial angiogenesis. The expression levels of lncRNA UCA1, miR-195 and CCND1 in human

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico