Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU151901

Sigma-Aldrich

MISSION® esiRNA

targeting human ZEB1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CATGGTGCAAGCTGTTGTTCTGCCAACAGTTGGTTTGGTGTCTCCCATAAGTATCAATTTAAGTGATATTCAGAATGTACTTAAAGTGGCGGTAGATGGTAATGTAATAAGGCAAGTGTTGGAGAATAATCAAGCCAATCTTGCATCCAAAGAACAAGAAACAATCAATGCTTCACCCATACAACAAGGTGGCCATTCTGTTATTTCAGCCATCAGTCTTCCTTTGGTTGATCAAGATGGAACAACCAAAATTATCATCAACTACAGTCTTGAGCAGCCTAGCCAACTTCAAGTTGTTCCTCAAAATTTAAAAAAAGAAAATCCAGTCGCTACAAACAGTTGTAAAAGTGAAAAGTTACCAGAAGATCTTACTGTTAAGTCTGAGAAGGACAAAAGCTTTGAAGGGG

Ensembl | nº de acceso humano

ENSG00000148516

Nº de acceso NCBI

NM_001128128

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... ZEB1(6935) , ZEB1(6935)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
NAV
UZU
DRU
ZQU
EQU

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Y-G Zhang et al.
European review for medical and pharmacological sciences, 22(9), 2662-2670 (2018-05-18)
To explore the expression of extracellular vesicle-derived lncZEB1-AS1 in esophageal cancer and its role in esophageal cancer progression. The extracellular vesicles (EVs) from esophageal cancer patients (n = 26) and normal subjects (n = 26) were isolated by differential centrifugation.
Ying Jiang et al.
OncoTargets and therapy, 12, 6093-6104 (2019-08-24)
Objective: Gastric cancer (GC) is a common tumor malignancy with high incidence and poor prognosis. Radiotherapy is one of the main strategies for GC treatment, while development of radioresistance limits the effectiveness. microRNA-203 (miR-203) has been reported to participate in
Guanlin Wu et al.
American journal of translational research, 9(8), 3599-3610 (2017-09-02)
Epigenetic gene inactivation by microRNAs (miRNAs) is crucial in malignant transformation, prevention of apoptosis, development of drug resistance, and metastasis. miR-204 dysregulation has been reported in prostate cancer (PC). It is considered to exert tumor suppressor functions and is associated
Hong-Yan Zhang et al.
Gene, 633, 61-65 (2017-08-28)
The myocardial infarction associated transcript (MIAT), a long non-coding RNA (lncRNA), was originally identified as a candidate gene for myocardial infarction, and was recently shown to participate in the progression of cancer and the process of metastasis. However, the biological
Qiongyan Zou et al.
Journal of cellular biochemistry, 119(2), 2189-2199 (2017-09-01)
Breast cancer (BC) is one of the leading causes of cancer deaths worldwide and the most common cancer among women. In our previous study, we revealed that lncRNA TP73-AS1 promotes breast cancer cell proliferation through directly binding to miR-200a. Herein
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico