Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU151571

Sigma-Aldrich

MISSION® esiRNA

targeting human TWIST1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización
Todas las fotos(1)

About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

100

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CGGACAAGCTGAGCAAGATTCAGACCCTCAAGCTGGCGGCCAGGTACATCGACTTCCTCTACCAGGTCCTCCAGAGCGACGAGCTGGACTCCAAGATGGCAAGCTGCAGCTATGTGGCTCACGAGCGGCTCAGCTACGCCTTCTCGGTCTGGAGGATGGAGGGGGCCTGGTCCATGTCCGCGTCCCACTAGCAGGCGGAGCCCCCCACCCCCTCAGCAGGGCCGGAGACCTAGATGTCATTGTTTCCAGAGAAGGAGAAAATGGACAGTCTAGAGACTCTGGAGCTGGATAACTAAAAATAAAAATATATGCCAAAGATTTTCTTGGAAATTAGAAGAGCAAAATCCAAATTCAAAGAAACAGGGCGTGGGGCGCACTTTTAAAAGAGAAAGCGAGACAGGCCCGTGGACAGTGATTCCCAGACGGGCAGCGGCACCATCCTCACACCTCTGCATTCTG

Ensembl | nº de acceso humano

ENSG00000122691

Nº de acceso NCBI

NM_000474

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

human ... TWIST1(7291) , TWIST1(7291)

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable

Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number
SIU
GDU
CAU
LXT
HKT

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

Busque por un COA

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Wei Li et al.
Oncology reports, 37(1), 185-192 (2016-11-24)
High expression of high mobility group protein A2 (HMGA2) is correlated with the invasiveness of gastric cancer and is an independent prognostic factor. The reason may be that HMGA2 promotes epithelial-mesenchymal transition (EMT) and the acquisition of tumor stem cell properties, yet
W Liu et al.
European review for medical and pharmacological sciences, 21(17), 3787-3793 (2017-10-05)
Endometrial carcinoma is the most common malignancy of the female genital tract. Therefore, there is an urgent need to understand the molecular mechanism of its metastasis. This study is aimed to explore the function and underlying mechanism of miR-326 in
Mairéad A Cleary et al.
Stem cells and development, 26(10), 751-761 (2017-03-17)
Human bone marrow-derived mesenchymal stem cells (BMSCs) are clinically promising to repair damaged articular cartilage. This study investigated TWIST1, an important transcriptional regulator in mesenchymal lineages, in BMSC chondrogenesis. We hypothesized that downregulation of TWIST1 expression is required for in
Yutian Wang et al.
Frontiers in microbiology, 11, 1301-1301 (2020-07-01)
Staphylococcus aureus (S. aureus) infection-induced osteomyelitis is a great challenge in clinic treatment. Identification of the essential genes and biological processes that are specifically changed in mononuclear cells at an early stage of S. aureus osteomyelitis is of great clinical
Shi Chen et al.
Cancer letters, 383(1), 73-84 (2016-10-30)
The epithelial-mesenchymal transition (EMT) plays a crucial role in pancreatic ductal adenocarcinoma (PDAC) development and progression. TWIST activated by intra-tumoral hypoxia functions to promote the EMT. We hypothesized that TWIST and the downstream gene pathway could mediate PDAC progression under
Ver todos los artículos relacionados

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico