Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU150831

Sigma-Aldrich

MISSION® esiRNA

targeting human CXCR3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

CCATGGTCCTTGAGGTGAGTGACCACCAAGTGCTAAATGACGCCGAGGTTGCCGCCCTCCTGGAGAACTTCAGCTCTTCCTATGACTATGGAGAAAACGAGAGTGACTCGTGCTGTACCTCCCCGCCCTGCCCACAGGACTTCAGCCTGAACTTCGACCGGGCCTTCCTGCCAGCCCTCTACAGCCTCCTCTTTCTGCTGGGGCTGCTGGGCAACGGCGCGGTGGCAGCCGTGCTGCTGAGCCGGCGGACAGCCCTGAGCAGCACCGACACCTTCCTGCTCCACCTAGCTGTAGCAGACACGCTGCTGGTGCTGACACTGCCGCTCTGGGCAGTGGACGCTGCCGTCCAGTGGGTCTTTGGCTCTGGCCTCTGCAAAGTGGCAGGTGCCCTCTTCAACATCAACTTCTACGCAGGAGCCCTCCTGCTGGCCTGCATCAGCTTTGACCGCTACCTGAAC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Categorías relacionadas

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Cecelia C Yates-Binder et al.
PloS one, 7(7), e40812-e40812 (2012-07-21)
Angiogenesis plays a critical role in processes such as organ development, wound healing, and tumor growth. It requires well-orchestrated integration of soluble and matrix factors and timely recognition of such signals to regulate this process. Previous work has shown that
Jinghua Du et al.
Theranostics, 7(17), 4192-4203 (2017-11-22)
Mitochondrial dysfunction plays a crucial role in the development of non-alcoholic steatohepatitis (NASH). However, the regulator of mitochondrial dysfunction in the pathogenesis of NASH is still largely unclear. CXCR3 is an essential pro-inflammatory factor in chronic liver diseases. We explored
Oisun Jung et al.
Journal of cell science, 132(20) (2019-09-29)
When targeted by the tumor-promoting enzyme heparanase, cleaved and shed syndecan-1 (Sdc1) then couples VEGFR2 (also known as KDR) to VLA-4, activating VEGFR2 and the directed migration of myeloma cells. But how VEGFR2 activates VLA-4-mediated motility has remained unknown. We now

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico