Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU149811

Sigma-Aldrich

MISSION® esiRNA

targeting human IGFBP5

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

AGTGTGGGCTTTTTCCCTTTTTTGCTCCTTTTCATTACCCCTCCTCCGTTTTCACCCTTCTCCGGACTTCGCGTAGAACCTGCGAATTTCGAAGAGGAGGTGGCAAAGTGGGAGAAAAGAGGTGTTAGGGTTTGGGGTTTTTTTGTTTTTGTTTTTGTTTTTTAATTTCTTGATTTCAACATTTTCTCCCACCCTCTCGGCTGCAGCCAACGCCTCTTACCTGTTCTGCGGCGCCGCGCACCGCTGGCAGCTGAGGGTTAGAAAGCGGGGTGTATTTTAGATTTTAAGCAAAAATTTTAAAGATAAATCCATTTTTCTCTCCCACCCCCAACGCCATCTCCACTGCATCCGATCTCATTATTTCGGTGGTTGCTTGGGGGTGAACAATTTTGTGGCTTTTTTTCCCCTATAATTCTGACCCGCTCAGGCTTGAGGGTTTCTCCGGCCTCCGCTCACTGCGTGCACCTGGCGCTGCCCTGCTTCCCCCAACCTGTTGCAAGGCTTTAATTCTTGCAACTGGGACCTG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

It looks like we've run into a problem, but you can still download Certificates of Analysis from our Documentos section.

Si necesita más asistencia, póngase en contacto con Atención al cliente

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Younghay Lee et al.
Cells, 8(4) (2019-04-26)
Type 2 diabetes mellitus (T2DM) is a prevalent chronic metabolic disorder accompanied by high blood glucose, insulin resistance, and relative insulin deficiency. Endoplasmic reticulum (ER) stress induced by high glucose and free fatty acids has been suggested as one of
Dong Hyup Lee et al.
The Korean journal of physiology & pharmacology : official journal of the Korean Physiological Society and the Korean Society of Pharmacology, 17(2), 157-162 (2013-04-30)
Insulin-like growth factor binding proteins (IGFBPs) are important components of insulin growth factor (IGF) signaling pathways. One of the binding proteins, IGFBP-5, enhances the actions of IGF-1, which include the enhanced proliferation of smooth muscle cells. In the present study
Bong-Ki Hong et al.
Experimental & molecular medicine, 49(8), e363-e363 (2017-08-05)
Fibroblast-like synoviocytes (FLSs) constitute a major cell subset of rheumatoid arthritis (RA) synovia. Dysregulation of microRNAs (miRNAs) has been implicated in activation and proliferation of RA-FLSs. However, the functional association of various miRNAs with their targets that are characteristic of
Wenyu Wang et al.
Molecular cancer therapeutics, 17(9), 1973-1983 (2018-06-22)
Despite showing promise against PIK3CA-mutant breast cancers in preclinical studies, PI3K/AKT pathway inhibitors demonstrate limited clinical efficacy as monotherapy. Here, we found that histone H3K27me3 demethylase KDM6B-targeted IGFBP5 expression provides a protective mechanism for PI3K/AKT inhibitor-induced apoptosis in breast cancer
Junyun Wang et al.
Oncotarget, 6(24), 20636-20649 (2015-05-27)
The insulin-like growth factor binding protein 5 (IGFBP5), which is often dysregulated in human cancers, plays a crucial role in carcinogenesis and cancer development. However, the function and underlying mechanism of IGFBP5 in tumor growth and metastasis has been elusive

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico