Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU149801

Sigma-Aldrich

MISSION® esiRNA

targeting human PLK3

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

GCAAGCAGTGGAGATGGATTTGAAGAAGGTCTGACTGTGGCCACAGTAGTGGAGTCAGCCCTTTGTGCTCTGAGAAATTGTATAGCCTTCATGCCCCCAGCGGAACAGAACCCGGCCCCCCTGGCCCAGCCAGAGCCTCTGGTGTGGGTCAGCAAGTGGGTTGACTACTCCAATAAGTTCGGCTTTGGGTATCAACTGTCCAGCCGCCGTGTGGCTGTGCTCTTCAACGATGGCACACATATGGCCCTGTCGGCCAACAGAAAGACTGTGCACTACAATCCCACCAGCACAAAGCACTTCTCCTTCTCCGTGGGTGCTGTGCCCCGGGCCCTGCAGCCTCAGCTGGGTATCCTGCGGTACTTCGCCTCCTACATGGAGCAGCACCTCATGAAGGGTGGAGATCTGCCCAGTGTGGAAGAGGTAGAGGTACCTGCTCCGCCCTTGCTGCTGCAGTGGGTCAAGACGGATCAGGCTCTCCTCATGCTGTTTAGTGATGGCACTGTCCAGGTGAACTTCTACGGGGACCAC

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Mahamat Babagana et al.
Molecular carcinogenesis, 59(1), 5-14 (2019-10-02)
The activation of oncogenic mitogen-activated protein kinase cascade via mutations in BRAF is often observed in human melanomas. Targeted inhibitors of BRAF (BRAFi), alone or as a part of a combination therapy, offer a significant benefit to such patients. Unfortunately
Cecilia Aquino Perez et al.
Cells, 9(6) (2020-06-25)
Polo-like kinases play essential roles in cell cycle control and mitosis. In contrast to other members of this kinase family, PLK3 has been reported to be activated upon cellular stress including DNA damage, hypoxia and osmotic stress. Here we knocked
Chellappagounder Thangavel et al.
Clinical cancer research : an official journal of the American Association for Cancer Research, 20(21), 5468-5482 (2014-08-29)
Perturbations in the retinoblastoma pathway are over-represented in advanced prostate cancer; retinoblastoma loss promotes bypass of first-line hormone therapy. Conversely, preliminary studies suggested that retinoblastoma-deficient tumors may become sensitized to a subset of DNA-damaging agents. Here, the molecular and in

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico