Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU148801

Sigma-Aldrich

MISSION® esiRNA

targeting human YBX1

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GGAGATGAGACCCAAGGTCAGCAGCCACCTCAACGTCGGTACCGCCGCAACTTCAATTACCGACGCAGACGCCCAGAAAACCCTAAACCACAAGATGGCAAAGAGACAAAAGCAGCCGATCCACCAGCTGAGAATTCGTCCGCTCCCGAGGCTGAGCAGGGCGGGGCTGAGTAAATGCCGGCTTACCATCTCTACCATCATCCGGTTTAGTCATCCAACAAGAAGAAATATGAAATTCCAGCAATAAGAAATGAACAAAAGATTGGAGCTGAAGACCTAAAGTGCTTGCTTTTTGCCCGTTGACCAGATAAATAGAACTATCTGCATTATCTATGCAGCATGGGGTTTTTATTATTTTTACCTAAAGACGTCTCTTTTTGGTAATAACAAACGTGTTTTTTAAAAAAGCCTGGTTTTTCTCAATACGCCTTTAAAGGTTTTTAAATTGTTTCATATCTGGTCAAGTTGAGATTTTTAAGAACTTCATTTTTAATTTGTAATAAAAGTTTACAACTTGATTTTTTCAAAAAAGTCAACAAACTGCAAGCACCTG

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Aneri Shah et al.
Cancers, 12(8) (2020-08-09)
Cell fate decisions regulating survival and death are essential for maintaining tissue homeostasis; dysregulation thereof can lead to tumor development. In some cases, survival and death are triggered by the same receptor, e.g., tumor necrosis factor (TNF)-receptor 1 (TNFR1). We
Cristina Pagano et al.
Oncotarget, 8(4), 6193-6205 (2016-12-23)
Correct spatial and temporal control of cell proliferation is of fundamental importance for tissue homeostasis. Its deregulation has been associated with several pathological conditions. In common with almost every aspect of plant and animal biology, cell proliferation is dominated by
Konstanze Lettau et al.
International journal of radiation oncology, biology, physics, 109(2), 567-580 (2020-09-16)
Y-box binding protein 1 (YB-1) overexpression is associated with chemotherapy- and radiation therapy resistance. Ionizing radiation (IR), receptor tyrosine kinase ligands, and mutation in KRAS gene stimulate activation of YB-1. YB-1 accelerates the repair of IR-induced DNA double-strand breaks (DSBs).
Wei Wang et al.
Experimental and therapeutic medicine, 14(1), 499-506 (2017-07-05)
Antimicrobial peptide LL-37 serves a function in the host defense against microbial invasion, and also regulates cell proliferation, immune activity and angiogenesis. Previous studies have reported that LL-37 participates in the development of numerous tumour types, such as ovarian cancer
Xueming Cao et al.
Free radical biology & medicine, 141, 10-20 (2019-06-04)
Y-box protein 1 (YB1) is a key regulator of inflammatory mediators. However, the roles of YB1 in oxidized low-density lipoprotein (ox-LDL)-induced macrophage inflammation and lipid uptake remain less understood. Thus, we explored the roles of YB1 in ox-LDL-induced macrophage inflammation

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico