Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Documentos clave

EHU145431

Sigma-Aldrich

MISSION® esiRNA

targeting human AICDA

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

Código UNSPSC:
41105324
NACRES:
NA.51

descripción

Powered by Eupheria Biotech

Nivel de calidad

Línea del producto

MISSION®

Formulario

lyophilized powder

secuencia objetivo ADNc esiRNA

ATTGCTCTTCCTCCGCTACATCTCGGACTGGGACCTAGACCCTGGCCGCTGCTACCGCGTCACCTGGTTCACCTCCTGGAGCCCCTGCTACGACTGTGCCCGACATGTGGCCGACTTTCTGCGAGGGAACCCCAACCTCAGTCTGAGGATCTTCACCGCGCGCCTCTACTTCTGTGAGGACCGCAAGGCTGAGCCCGAGGGGCTGCGGCGGCTGCACCGCGCCGGGGTGCAAATAGCCATCATGACCTTCAAAGATTATTTTTACTGCTGGAATACTTTTGTAGAAAACCACGAAAGAACTTTCAAAGCCTGGGAAGGGCTGCATGAAAATTCAGTTCGTCTCTCCAGACAGCTTCGGCGCATCCTTTTGCCCCTGTATGAG

Ensembl | nº de acceso humano

Nº de acceso NCBI

Condiciones de envío

ambient

temp. de almacenamiento

−20°C

Información sobre el gen

Descripción general

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Información legal

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Código de clase de almacenamiento

10 - Combustible liquids

Punto de inflamabilidad (°F)

Not applicable

Punto de inflamabilidad (°C)

Not applicable


Elija entre una de las versiones más recientes:

Certificados de análisis (COA)

Lot/Batch Number

¿No ve la versión correcta?

Si necesita una versión concreta, puede buscar un certificado específico por el número de lote.

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Xudong Ao et al.
Cytotechnology, 68(6), 2637-2648 (2016-08-11)
DNA methylation in mammals is an epigenetic marker and necessary for normal embryogenesis. The global genomic demethylation of 5-methylcytosine occurs during the first cell cycle following fertilization. Activation-induced cytidine deaminase (AID), which is well-known for the function in antibody diversification
Grant Godsmark et al.
Anticancer research, 41(1), 237-247 (2021-01-10)
Activation-induced cytidine deaminase (AID) is a DNA modifying enzyme which has an essential function in promoting antibody diversification. Its overexpression is strongly associated with B-cell derived malignancies including Burkitt lymphoma, where AID is required for the characteristic c-MYC/IGH translocation. This
Yugo Sawai et al.
Cancer research, 75(16), 3292-3301 (2015-06-27)
Pancreatic ductal adenocarcinoma (PDAC) develops via an accumulation of various gene mutations. The mechanism underlying the mutations in PDAC development, however, is not fully understood. Recent insight into the close association between the mutation pattern of various cancers and specific

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico