Saltar al contenido
MilliporeSigma
Todas las fotos(1)

Key Documents

EHU144761

Sigma-Aldrich

MISSION® esiRNA

targeting human CHD8

Iniciar sesiónpara Ver la Fijación de precios por contrato y de la organización


About This Item

UNSPSC Code:
41105324
NACRES:
NA.51

description

Powered by Eupheria Biotech

Quality Level

product line

MISSION®

form

lyophilized powder

esiRNA cDNA target sequence

GTTGCGGGTACGAATGCTATACTACCTGAGGCAGGAGGTTATTGGAGACCAAGCAGAAAAGGTGTTAGGGGGTGCGATTGCCAGTGAGATTGACATATGGTTCCCAGTAGTGGATCAACTGGAGGTTCCAACAACTTGGTGGGACAGTGAGGCTGACAAGTCGCTGCTCATTGGAGTCTTTAAACATGGCTATGAGAAATATAATACCATGAGGGCAGACCCAGCCTTATGTTTCCTAGAAAAGGCTGGCCGACCAGATGACAAAGCAATTGCAGCAGAACATCGAGTGTTGGATAACTTCTCTGACATAGTAGAAGGGGTTGACTTTGATAAAGATTGTGAAGATCCTGAATATAAACCACTCCAAGGTCCCCCAAAGGACCAAGATGATGAGGGTGATCCCTTGATGATGATGGATGAGGAGATCTCAGTGATTGATGGAGATGAAGCCCAGGTGACCCAACAGCCAGGCCATTTATT

Ensembl | human accession no.

NCBI accession no.

shipped in

ambient

storage temp.

−20°C

Gene Information

General description

MISSION esiRNA are endoribonuclease prepared siRNA. They are a heterogeneous mixture of siRNA that all target the same mRNA sequence. These multiple silencing triggers lead to highly-specific and effective gene silencing.

For additional details as well as to view all available esiRNA options, please visit SigmaAldrich.com/esiRNA.

Legal Information

MISSION is a registered trademark of Merck KGaA, Darmstadt, Germany

Storage Class

10 - Combustible liquids

flash_point_f

Not applicable

flash_point_c

Not applicable


Certificados de análisis (COA)

Busque Certificados de análisis (COA) introduciendo el número de lote del producto. Los números de lote se encuentran en la etiqueta del producto después de las palabras «Lot» o «Batch»

¿Ya tiene este producto?

Encuentre la documentación para los productos que ha comprado recientemente en la Biblioteca de documentos.

Visite la Librería de documentos

Justin Cotney et al.
Nature communications, 6, 6404-6404 (2015-03-11)
Recent studies implicate chromatin modifiers in autism spectrum disorder (ASD) through the identification of recurrent de novo loss of function mutations in affected individuals. ASD risk genes are co-expressed in human midfetal cortex, suggesting that ASD risk genes converge in
Chuntao Zhao et al.
Developmental cell, 45(6), 753-768 (2018-06-20)
Disruptive mutations in chromatin remodeler CHD8 cause autism spectrum disorders, exhibiting widespread white matter abnormalities; however, the underlying mechanisms remain elusive. We show that cell-type specific Chd8 deletion in oligodendrocyte progenitors, but not in neurons, results in myelination defects, revealing
María Ceballos-Chávez et al.
PLoS genetics, 11(4), e1005174-e1005174 (2015-04-22)
While the importance of gene enhancers in transcriptional regulation is well established, the mechanisms and the protein factors that determine enhancers activity have only recently begun to be unravelled. Recent studies have shown that progesterone receptor (PR) binds regions that

Nuestro equipo de científicos tiene experiencia en todas las áreas de investigación: Ciencias de la vida, Ciencia de los materiales, Síntesis química, Cromatografía, Analítica y muchas otras.

Póngase en contacto con el Servicio técnico